Natural killer (NK) cells exert anticancer activity by recognizing NK cell ligands on tumor cells, mediating antibody-dependent cell-mediated cytotoxicity, and releasing interferon gamma (IFNγ). Upon receptor-ligand interaction, activated NK cells secrete granzymes and perforin, which initiate apoptosis in target cells (Kollipara et al., 2014). This can be measured by either the CD107a exposure of NK cells or an increase in the levels of granzymes and perforin. In addition to directly interacting with cancer cells, activated NK cells are known to secrete cytokines, including granulocyte-macrophage colony-stimulating factor, tumor necrosis factor alpha, and IFNγ to promote the activity of other immune cells (Romee et al., 2014).

Various herbal medicines, also known as phytochemicals, have been shown to directly activate human NK cells. For example, after administering ginseng extract to mice for 6 weeks, NK cells isolated from the spleen showed increased tumor lytic activity against the mouse lymphoma cell line YAC-1 (Lee et al., 2019). Furthermore, in hepatoma H22-bearing mice treated with Scutellaria barbata D. Don extract (SBE) for 30 days, the tumor volume in the SBE-treated group reduced compared to the control group, and the cytolytic function of splenic NK cells against K562 cells was enhanced upon treatment with SBE (Kan et al., 2017). Various specific substances within herbal medicines have been identified to enhance NK cell function. The administration of curcumin from Curcuma longa has been shown to elevate the number of CD16⁺CD56^dim NK cells, which, in turn, increases apoptosis in target cancer cells (Wang et al., 2020). Proanthocyanidins from grape seeds were administered to tumor-bearing mice for 10 days, resulting in enhanced cytolytic function of splenic NK cells against YAC-1 cells (Zhang et al., 2005). Extracts from various plants and natural compounds are frequently used as health supplements to support immune cell function.

Resveratrol (trans-3,5,4’-trihydroxy stilbene) is a polyphenolic compound present in grapes, Polygonum cuspidatum, and peanut sprouts (Singh et al., 2007). Resveratrol is a well-known antioxidant that scavenges free radicals in cells (Pezzuto, 2019). The anticancer activity of resveratrol, including the inhibition of tumor cell proliferation and programmed cell death ligand 1 expression, has been widely studied (Ko et al., 2017; Verdura et al., 2020). Resveratrol has been shown to enhance the cytolytic function against target cancer cells by activating NK cells (Li et al., 2014). The enhanced cytolytic activity of NK cells against tumor- or virus-infected cells has been attributed to increased perforin levels, activation of the p38 and ERK-1/2 pathways (Lu and Chen, 2010), and upregulation of CD107a, NKp30, and NKG2D expression following resveratrol treatment (Lee et al., 2021). Additionally, resveratrol induces sirtuin1 (SIRT1), which has a protective function in the NK cells of older individuals (Kaszubowska et al., 2017).

Peanut sprout extracts cultivated in fermented sawdust medium (PSEFS) was developed by Resvera Co. as an ingredient for formulating health supplements. Traditionally, peanut sprouts are cultivated using hydroponic technology, which is cost-effective; however, it poses the risks of heightened environmental pollution and pathogenic infections (El-Kazzaz and El-Kazzaz, 2017). Compared with traditional methods, this novel technique, which utilizes fermented sawdust, reduces the production of harmful substances while providing a rich nutrient profile, particularly that of resveratrol (Song et al., 2020). PSEFS reportedly reduced benign prostate hyperplasia (BPH) in a rat model, exhibiting efficacy similar to that of finasteride (Song et al., 2020). Notably, resveratrol was shown to inhibit the progression of BPH (Chung et al., 2015; Li et al., 2019), suggesting that resveratrol-enriched PSEFS may elicit health benefits similar to those of resveratrol.

Therefore, similar to resveratrol, PSEFS is expected to exert multiple health benefits, including antioxidant, anti-inflammatory, antitumor, and antiobesity effects. In this study, we assessed the beneficial effects of peanut sprout extract on human NK cell immunity, akin to those of resveratrol, which enhances immune cell activity and exerts antitumor effects.

Ethics statement

All animal experiments were reviewed and approved by the Ethics Committee for the Care and Use of Laboratory Animals at the Korea Research Institute of Bioscience and Biotechnology (approval number KRIBB-AEC-20177).

Cell culture

Human natural killer cell line NK92, human lung carcinoma cell line H1299, and mouse lymphoma cell line YAC-1 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). NK92 cells were maintained in alpha minimum essential medium (α-MEM; Gibco, New York, NY, USA) supplemented with 12.5% heat-inactivated fetal bovine serum (FBS; Seradigm, Radnor, PA, USA), 12.5% heat-inactivated horse serum (Gibco, Carlsbad, CA, USA), 0.2 mM myo-inositol, 0.1 mM 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA), 0.02 mM folic acid (Sigma-Aldrich), 1% antibiotics-antimycotics (anti-anti, Gibco), and 20 ng/mL interleukin (IL)-2 (Peprotech, Rocky Hill, NJ, USA). H1299 and YAC-1 cells were maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS and 1% anti-anti. All cell lines were cultured at 37°C in a humidified incubator with 5% CO₂.

Sample preparation

Resveratrol was purchased from the Tokyo Chemical Industry (Tokyo, Japan). PSEFS was provided by Resvera Co. (Cheongju, Korea). Resveratrol was dissolved in a mixture of ethanol and water in a 50% (v/v) proportion; PSEFS was dissolved in water. The samples, prepared as described above, were directly applied to NK92 cells according to their concentrations and used in the experiment. Composition analysis of PSEFS was conducted by the Noguchi Medical Research Institute (Tokyo, Japan), revealing a resveratrol content of 64 ppm (Table 1).

Table 1 Analytic results of ingredient quantification in PSEFS sample from the Noguchi Medical Research Institute

Sample name: Peanut bud powder
Test Item	Result	Method
Folic acid	290 µg/100 g	1
Aspartic acid	2.92 g/100 g	2
Resveratrol	6.4 mg/100 g	3
Saponins	11.8 g/100 g	4
Aerobic plate count	Not more than 300/g	5
Coliform bacteria	Negative/ 2.22 g	6
Coagulase positive staphylococci	Negative/ 0.01 g	7

Method

1: Microbiological assay

2: Amino acid analyzer method

3: Liquid chromatography-mass spectrometry

4: Gravimetric method

5: Standard Agar plating method

6: BGLB broth inoculating method

7: Surface spread plating method

In vitro cytotoxicity assay

The cytotoxicity of NK cells against target tumor cells was assessed using the Calcein release assay. One million/mL of tumor cells were labeled with 8 μM Calcein-AM (Invitrogen, Carlsbad, CA, USA) for 30 min at 37°C under 5% CO₂. After washed with phosphate-buffered saline twice, the calcein-stained target cells were loaded into a 96-well round plate at 1×10⁴ cells/well. NK cells were dispensed at different effector (E) to target (T) ratios and cocultured for 4 h. “spontaneous release” was simulated by incubating the calcein-stained target cells only, and “maximum release” was achieved by incubating the calcein-stained target cells in medium with 2% Triton X-100. The release of calcein from lysed tumor cells induced by NK cell lytic activity was quantified using a microplate reader (excitation: 485 nm/emission: 535 nm, Spectramax i3x, Molecular Devices, San Jose, CA, USA).

The percentage of cytotoxicity for each experimental group was calculated using the following formula, based on the mean of triplicate measurements:

Flow cytometry

PSEFS- or resveratrol-treated NK92 cells were washed, followed by stained with antibodies in FACS buffer (2% FBS in PBS) for 30 min. Subsequently, the NK92 cells were washed twice, and the fluorescence was measured using a flow cytometer (Canto II, BD Biosciences, Sparks, MD, USA). We used FlowJo software (Tree Star, Ashland, OR, USA) for FACS data analysis. BV421-conjugated anti-human CD56, APC-conjugated anti-human NKG2D, PE-conjugated anti-human NKp30, APC-conjugated anti-human NKp46, PE-conjugated anti-human NKp44 antibodies were purchased from BD Biosciences. For the CD107a degranulation assay, NK92 cells and H1299 cells were co-incubated in a 96-well round-bottom plate and Effector-to-Target ratio of 3:1 for 4 h. During co-incubation, an anti-CD107a antibody was included. Following incubation, NK cells were harvested and stained with an anti-CD56 antibody staining for an additional 30 min before being analyzed using a flow cytometer.

Western blot analysis

PSEFS- or resveratrol-treated NK92 cells were washed with ice-cold PBS and lysed in RIPA cell lysis buffer (R0278; Sigma-Aldrich) in the presence of protease inhibitors, phosphatase inhibitors (Millipore, MA, USA), and dithiothreitol (Shakya et al., 2023). To load the same protein amount among samples, we quantified the whole-cell extracts using the bicinchoninic acid (BCA) assay. Protein samples were separated on 10% polyacrylamide gels using Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto polyvinylidene fluoride membranes (Millipore). After blocking in 5% skim milk (w/v) in PBS-T buffer (0.05% Tween-20 in PBS) for 30 minutes, the membranes were exposed to primary antibodies overnight at 4°C. Primary antibodies used were anti-SIRT1 (#9475, 1:1000), anti-SIRT3 (#5490, 1:1000), anti-ERK (#9102, 1:1000), anti-pERK (#9101, 1:1000), anti-GZMB (#4275, 1:1000), anti-p38 (#9212, 1:1000), anti-pp38 (#4511, 1:1000) from Cell Signaling Technology (Danvers, MA, USA). Secondary horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG antibody was obtained from Thermo Fisher Scientific Inc. (Waltham, MA), and HRP-conjugated anti-β-Actin (A3854, 1:25000) from Sigma-Aldrich. The intensity of the protein bands was detected and analyzed using enhanced chemiluminescence method with the CSAnalyzer4 (ATTO Technology, NY, USA).

Quantitative PCR (qPCR) analysis

Total RNA extraction from NK cells was conducted using GeneALL Ribospin II (GeneALL, Seoul, Korea) according to the manufacturer’s instruction. cDNA was synthesized using ReverTra Ace –α-TM (TOYOBO, Osaka, Japan, FSK-101F) (Jung et al., 2024), and the cDNA samples were used as templates for subsequent PCR amplification of GZMB, IFNG, PRF1, DNAM1, NKG2D, NKp44, ERK, CTLA4, and SIRT1. The following primers were used:

GZMB Fw: 5’-GGCTTCCTGATACGAGACGA

GZMB Rev: 5’- AGGGATAAACTGCTGGGTCG

IFNG Fw: 5’-TGGTTGTCCTGCCTGCAATA

IFNG Rev: 5’-TAGGTTGGCTGCCTAGTTGG

PRF1 Fw: 5’-CGGCTATCGTTAGTGCTAGTG

PRF1 Rev: 5’-CTGTCTGATGCGTATCCAATCT

DNAM1 Fw: 5’-GATGTTGGCTACTATTCCTGCTC

DNAM1 Rev: 5’-CTGAACCACCTGTATCACCTTC

NKG2D Fw: 5’-CTGGGAGATGAGTGAATTTCATA

NKG2D Rev: 5’- GACTTCACCAGTTTAAGTAAATC

NKp44 Fw: 5’-GTGGTATCTCCAGCCTCTGC

NKp44 Rev: 5’-CACACAGCTCTGGGTCTGAG

ERK Fw: 5’-GCTGTTCCCAAATGCTGACT

ERK Rev: 5’-TCGGGTCGTAATACTGCTCC

CTLA4 Fw: 5’-ACACGGGACTCTACATCTGC

CTLA4 Rev: 5’-AATCTGGGTTCCGTTGCCTA

SIRT1 Fw: 5’-TCCAGATCCTCAAGCGATGT

SIRT1 Rev: 5’-AACCTGTTCCAGCGTGTCTA

GAPDH Fw: 5’-CCAAGGAGTAAGACCCCTGG

GAPDH Rev: 5’- AGGGGAGATTCAGTCTGGTG

qPCR analysis was conducted using RealAmp SYBR^TM qPCR Master mix (GeneALL, Seoul, Korea), and amplification was performed on a Viia7 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The Ct values for each sample were measured in duplicates or triplicates. The standard curve method, along with normalization to GAPDH levels, was used to quantify gene expression.

Lactate dehydrogenase (LDH) release assay

To measure the toxicity of PSEFS or resveratrol on NK92 cells, LDH assay kit (Dogenbio, Seoul, Korea) was used. NK92 cells were treated with PSEFS or resveratrol for 48 h. A 96-well plate with a cell density of 1×10⁴ cells/well was used for subsequent processes, such as adding 100 μL of LDH substrate solution to each supernatant. According to the manufacturer’s instruction, each well was measured at 450 nm using a microplate reader (Kim et al., 2023).

NK cell activity following PSEFS or resveratrol administration in vivo

Six-week-old C57BL/6 male mice (Dooyeol Biotech, Seoul, Korea) were acclimatized in a temperature- and humidity-controlled manner with access to a standard diet and drinking water for 7 days. The mice were orally administered the vehicle control (distilled water), 50 mg/kg PSEFS, or 200 mg/kg PSEFS daily for two weeks. For resveratrol, 10% dimethyl sulfoxide in PBS was used as a vehicle control, 0.01 mg/kg, 1 mg/kg, or 10 mg/kg resveratrol were orally administered for two weeks. On day 15, the mice spleens were extracted after anesthetized with 1.2% avertin (2,2,2-Tribromoethanol, T48405, Sigma-Aldrich). Plasma was used for IFN-γ analysis. The harvested and washed spleens were homogenized using a syringe and the splenocytes were collected. Erythrocytes were removed by treatment with 1 × ACK buffer (0.15 M NH₄CL, 1.0 mM KHCO₃, 0.1 mM EDTA, pH 7.4). Flow cytometric analysis was conducted to examine immune cell populations among the splenocytes. Mouse NK cells were isolated using the EasySep Mouse NK Cell Isolation Kit (#19855, STEMCELL Technology, Vancouver, Canada). Splenic NK cells were resuspended in RPMI, supplemented with 10% FBS, 20 ng/mL hIL-2, and 10 ng/mL hIL-15, and incubated for 16 h. A calcein release assay was used to evaluate the cytolytic activity of mice splenic NK cells against YAC-1 cells.

Enzyme-linked immunosorbent assay (ELISA)

A mouse IFNγ uncoated ELISA kit was purchased from Invitrogen. Mouse plasma samples were obtained and applied in triplicates to a 96-well microplate pre-coated with the capture antibody and incubated for 2 h. The wells were washed in washing buffer (1× PBS containing 0.05% Triton X-100), and the detection antibody along with HRP peroxidase was added subsequently for the next 1-h incubation. The substrate solution 3,3′,5,5′-tetramethylbenzidine was treated in dark and absorbance was measured at 450 and 570 nm in a microplate reader.

Statistical analysis

Data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using two-tailed unpaired t-tests or the linear regression model for 2-group comparisons and one-way analysis of variance (ANOVA) for multiple-group comparisons. Data analyses were performed using GraphPad Prism 6.0 (GraphPad Software, Boston, MA, USA). P values ≤0.05 were deemed statistically significant.

PSEFS- or resveratrol-treated NK cells enhance lysis of lung cancer cells

Resveratrol increases the antitumor activity of NK cells. Given that PSEFS contains a high amount of resveratrol, we hypothesized that PSEFS activates NK cells to enhance tumor cell lytic activity. We used the lung cancer cell line H1299 as target cells for the cytotoxicity assay and found that PSEFS increased NK cell activity in a dose-dependent manner (Fig. 1A). Resveratrol-treated NK cells showed enhanced cytotoxicity (Fig. 1B). PSEFS contained 64 ppm resveratrol (as provided by Resvera Co., performed at the Noguchi Medical Research Institute). Therefore, 250 µg/mL PSEFS contains 0.1 µM of resveratrol. Notably, the NK cell cytolytic activity exerted by 250 µg/mL of PSEFS exceeded the effect of 0.1 µM of resveratrol. Consequently, we hypothesized that PSEFS effectively enhances the cytolytic activity of NK cells.

Figure 1. PSEFS- or resveratrol-treated NK cells enhance lysis of lung cancer cells. (A, B) NK cell cytotoxicity was measured using the calcein-AM assay. NK92 cells were treated with either PSEFS (A) or resveratrol (B) for 48 h and then co-cultured with H1299 at a 3:1 ratio (effector to target cells) for 4 h. The percentage of target cell lysis from three-seven independent experiments was measured. (C) Cytotoxicity of NK92 cells treated with PSEFS was determined by LDH release assay. NK92 cells (1×10⁴) were incubated with PSEFS for 48 h, and LDH release in the supernatant was quantified from three independent experiments. (D) The effects of PSEFS or resveratrol on H1299 were evaluated from three independent experiments by treating target cells with 2.5 μM resveratrol or 250 μg/mL PSEFS for 48 h, followed by co-cultured with NK92 cells. All data are expressed as mean ± SD; statistical significance was assessed with unpaired t-tests. *p<0.05, **p<0.01, ***p<0.001. LDH, lactate dehydrogenase; PSEFS, peanut sprout extracts cultivated with fermented sawdust medium; SD, standard deviation.

To confirm the absence of toxicity in NK cells after PSEFS treatment, an LDH release assay was performed. According to the assay results, PSEFS did not exert any detrimental effects on NK cells at examined concentrations (Fig. 1C). Additionally, to determine whether the target cells were affected, we treated H1299 cells with PSEFS or resveratrol before conducting cytotoxicity assays using control NK cells. PSEFS- or resveratrol-treated H1299 cells were not sensitized to the enhanced cytotoxicity induced by NK cells (Fig. 1D). Accordingly, PSEFS- or resveratrol-induced antitumor activity could be attributed to the direct activation of NK cells.

Assessment of NK cell activation by PSEFS using flow cytometry

Exposure of CD107a is directly associated with the cytolytic activity of NK cells, indicating the release of lytic enzymes, such as granzyme B. NK cells were co-cultured with H1299 cells for 4 h, and CD107a exposure on the NK cell surface was measured. Treatment with PSEFS significantly increased CD107a expression (Fig. 2A). Furthermore, we examined the expression of NK cell activation receptors, including NKp30, NKG2D, NKp44, and NKp46. Treatment with PSEFS significantly increased the expression of NKp30 and NKp46 (Fig. 2B). Likewise, resveratrol treatment significantly increased NKG2D, NKp44, and NKp46 levels (Fig. 2C). Among these receptors, NKp30 and NKp46 are known to play a crucial role in NK-mediated cytolytic activity through CD3ζ signaling in activated NK cells (Pandey et al., 2007). These results suggested that PSEFS and resveratrol slightly upregulated NK cell activation receptors, potentially enhancing NK cell cytolytic functions.

Figure 2. Effects of PSEFS and resveratrol on CD107a expression and NK cell activating receptors. (A) Expression of CD107a on the surface of NK92 cells was measured by performing flow cytometry. NK92 cells were treated with PSEFS and then co-cultured with H1299 at a 3:1 ratio for 4 h. The percentage of CD56⁺CD107a⁺ cells was quantitatively analyzed from four-six independent experiments. (B, C) Expression of NK cell-activating receptors was measured. NK92 cells were treated with either PSEFS (B) or resveratrol (C) for 48 h. The fold change of mean fluorescence intensity (MFI) was obtained from two-three independent experiments. All data are expressed as mean ± SD; statistical significance was assessed with unpaired t-tests. *p<0.05, **p<0.01. PSEFS, Peanut sprout extracts cultivated with fermented sawdust medium; SD, standard deviation.

PSEFS induces the upregulation of signaling molecules of NK cells

Resveratrol has been shown to enhance NK cell cytotoxic activity via the activation of MAPK pathways, such as ERK and p38. We performed western blotting on NK cells to elucidate the mechanism of action of PSEFS and resveratrol. Both PSEFS and resveratrol increased phospho-ERK protein levels in NK cells. The phospho-p38 protein level also increased in NK cells upon PSEFS treatment, although the difference was not statistically significant (Fig. 3A, 3B). The role of resveratrol as a SIRT activator has been extensively explored (Cao et al., 2015). Consistently, our western blot analysis confirmed that resveratrol treatment increased the expression of SIRT1 and SIRT3 (Fig. 3B). Interestingly, PSEFS treatment also significantly increased the expression of SIRT1 and SIRT3 (Fig. 3A), suggesting that PSEFS may exhibit effects similar to those of resveratrol owing to its high concentration. Given the limited understanding of the functions of SIRT1 and SIRT3 in NK cells, further research is necessary. Additionally, an increase in protein expression of granzyme B was observed in both PSEFS- and resveratrol-treated NK cells. qPCR analysis revealed that treatment with PSEFS upregulated the expression of NK cell activation genes, including GZMB, IFNG, PRF1, DNAM1, NKG2D, NKp44, ERK, and SIRT1, whereas the inhibitory receptor CTLA4 was downregulated (Fig. 3C). In summary, PSEFS increased NK cell activity via activation mechanisms similar to those of resveratrol.

Figure 3. Mechanisms of PSEFS-induced NK cell activation. (A) Representative western blot image for p38, ERK, SIRT1, SIRT3 and granzyme B levels in NK92 cells treated with PSEFS for 2 h at the indicated concentrations from three independent experiments. β-Actin was used as a loading control. Quantification of fold changes in intensity was determined using CSAnalyzer 4 (right panels). (B) Representative and quantification of western blotting of NK92 cells treated with resveratrol for 2 h from three independent experiments. (C) Expression of several genes involved in NK92 activation was measured from three-five independent experiments by qPCR. Fold change in mRNA levels compared with the control group are shown. NK92 cells were treated with PSEFS or resveratrol for 48h. All data are expressed as mean ± SD; statistical significance was assessed with unpaired t-tests. *p<0.05, **p<0.01, ***p<0.001. PSEFS, Peanut sprout extracts cultivated with fermented sawdust medium; SD, standard deviation.

Enrichment of NK cell population in spleen and cytokine release function by PSEFS administration in vivo

To examine the PSEFS-mediated effects on NK cells in vivo, we conducted experiments using three groups: control, 50 mg/kg PSEFS, and 200 mg/kg PSEFS. Upon completion of PSEFS treatment, each group of mice was sacrificed, and the spleen and whole blood samples were obtained. Mouse NK cells and cytotoxic T cells in splenocytes were gated as CD3-NK1.1⁺ and CD3⁺CD8⁺, respectively. The PSEFS-treated group showed a significant increase in NK cells when compared with the control group; however, there were no significant differences in terms of cytotoxic T cells (Fig. 4A). Additionally, plasma was isolated from the whole blood and analyzed using an IFNγ ELISA kit, revealing a significant increase in absorbance index of IFNγ at 200 mg/kg (Fig. 4B).

Figure 4. Enrichment of NK cell population in mouse spleen after oral administration of PSEFS. (A) Flow cytometry to quantify NK cells and cytotoxic T cells in spleens from each group. Each cell was analyzed as CD3-NK1.1⁺ and CD3⁺CD8⁺ respectively. (B) Plasma was obtained from the whole blood, and the absorbance index of IFN-γ was determined using a mouse IFN-γ ELISA kit by detecting optical density at 450nm. All data are expressed as mean ± SD; statistical significance was assessed with unpaired t-tests. *p<0.05, **p<0.01. PSEFS, Peanut sprout extracts cultivated with fermented sawdust medium; SD, standard deviation.

PSEFS administration enhances cytolytic activity in NK cells through lytic granules and cytokine in mice

Splenic NK cells were isolated from spleens of PSEFS-fed mice in each experimental group using an EasySep Mouse NK Cell Isolation Kit. Subsequently, NK cells were assessed for their cytotoxicity against YAC-1 cells at ratios of 10:1, 5:1, and 1:1. We observed a slight increase in cytotoxicity at 50 mg/kg and a significant increase in cytotoxicity at 200 mg/kg PSEFS, with the latter showing approximately a two-fold increase compared to the vehicle control (Fig. 5A). Oral administration of resveratrol also enhanced the cytotoxicity of splenic NK cells against target cells, although it was less effective than PSESF in terms of dose-dependency and potentiation compared to the vehicle control (Fig. 5B). Thereafter, we examined the relative mRNA levels of Nkg2d and NK cell cytolysis-associated genes using qPCR analysis. Expression of Nkg2d showed a slight but non-significant concentration-dependent increase, whereas the cytolytic genes Gzmb, Ifng, and Prf1 showed a significant increase in splenic NK cells upon PSEFS administration (Fig. 5C). These results confirmed that PSEFS can enhance the cytolytic activity of NK cells against tumor cells by inducing an increase in lytic granules and cytokines in NK cells in vivo. The mechanism of action of PSEFS enriched with resveratrol on NK cell activity is depicted in Fig. 6.

Figure 5. PSEFS administration enhances antitumor lytic activity of NK cells in mice. (A, B) The mouse splenic NK cell cytolytic activity against YAC-1 cells was measured at the indicated effector-to-target cell ratio (E:T). After oral administration of PSEFS or resveratrol daily for 2 weeks, the mouse splenic NK cells were isolated from splenocytes using an NK isolation kit. (C) Relative mRNA levels of NK cell activation genes were analyzed using qPCR. All data are expressed as mean ± SD; statistical significance was assessed with unpaired t-tests. *p<0.05, **p<0.01, ***p<0.001. PSEFS, Peanut sprout extracts cultivated with fermented sawdust medium; SD, standard deviation.

Figure 6. Proposed mechanism of action of PSEFS enriched with resveratrol on NK cell activity. PSEFS enhances NK cell cytotoxicity against tumor cells by activating ERK and p38 signaling pathways, likely through the beneficial effects of resveratrol. NK cells treated with PSEFS or resveratrol exhibit increased expression of lytic enzymes and activation receptors, leading to enhanced antitumor activity.

In this study, we demonstrated that PSEFS improved NK cell cytotoxicity against tumor cells by enhancing the ERK and p38 signaling pathways, resembling the NK cell stimulation mechanism triggered by resveratrol. PSEFS upregulated lytic enzymes and cytokines, such as granzyme B and IFNγ, respectively, in NK cells by activating the MAPK pathway. PSEFS-treated NK cells exhibited elevated expression levels of CD107a and NKp30, which facilitate the secretion of lytic enzymes (Pinheiro et al., 2020). Additionally, oral administration of PSEFS significantly enhanced anti-tumor cytolytic function of NK cells in mice, suggesting its potential role in immune boosting and health benefit. PSEFS has been developed to enrich resveratrol. Thus, we compared them in most of data, resulting in similar to better efficacy of PSEFS over resveratrol in NK cell activation.

Resveratrol promotes health via SIRT1 activity (Iside et al., 2020). SIRT1 and SIRT3 are known to regulate redox signaling and oxidative stress. Specifically, SIRT1 activation reportedly enhances age-dependent antioxidant responses and maintains cellular function and lifespan in mice by reducing reactive oxygen species-induced mitochondrial dysfunction (Singh et al., 2018). Increased SIRT1 expression in NK cells appears to correlate with longevity, suggesting that it plays a role in establishing NK cell homeostasis during healthy aging (Kaszubowska et al., 2017). In our study, both PSEFS and resveratrol increased SIRT1 and SIRT3 levels in NK cells. The mechanisms underlying the involvement of sirtuins in resveratrol-induced cytolytic activity of NK cells remain unclear. One possible explanation is that SIRT1 regulates mitochondrial function via PGC-1α in cells (Gerhart-Hines et al., 2007; Price et al., 2012), which is also critical in promoting NK cell activity (Zheng et al., 2019).

Based on our findings, PSEFS could exert comparable efficacy to resveratrol at approximately 10-fold lower concentrations, suggesting that the bioavailability of resveratrol may be enhanced. Specifically, 250 µg/mL PSEFS, containing 0.1 µM resveratrol, increased the cytolytic activity of NK cells and showed similar efficacy to 1 µM resveratrol (Fig. 1A, 1B). Furthermore, oral administration of 200 mg/kg PSEFS enhanced NK cell function by 1.5-fold when compared with the control, whereas an approximately 1.3-fold increase was observed upon administering an equivalent resveratrol dose (0.01 mg/kg) to mice (Fig. 5A, 5B). Notably, resveratrol did not demonstrate dose-dependent effects in the in vivo experiments. Consistently, the low bioavailability of resveratrol could be attributed to the limited water solubility (Zupančič et al., 2015), as well as rapid metabolism in the intestine and liver (Walle, 2011). Nevertheless, resveratrol has some limitations. For instance, the intake of resveratrol in drinking water (1 mg/kg/day) for 45 days induced hepatic oxidative stress in a rat model fed a standard diet (Rocha et al., 2009). Additionally, high-dose administration of resveratrol (≥50 mg/kg/day) by intraperitoneal injection for 14 days induced kidney damage caused by unilateral ureteral obstruction in mice (Liu et al., 2019). Although we did not detect notable toxicity following a two-week administration of PSEFS or resveratrol at all doses, the toxicity of PSEFS needs to be explored in future investigations to comprehensively clarify the advantages of PSEFS over resveratrol.

PSEFS comprises not only resveratrol but also aspartic acid (2.92 g/100 g), folic acid (0.29 mg/100 g), and saponins (11.8 g/100 g) (Table 1). To the best of our knowledge, there is no report suggesting that aspartic acid or folic acid can enhance NK cell cytotoxicity function in vitro. Furthermore, high concentrations of folic acid (daily recommended dose, 2 mg/kg) reduced NK cell activity in murine models (Sawaengsri et al., 2016). However, saponins have been shown to enhance the function of NK cells. For example, a 4-week regimen of ginsenoside (ginseng saponins) concentrate at 200 and 400 mg/kg elevated NK cell cytotoxicity against YAC-1 cells (Jang et al., 2024). Ginsenoside Rg3 enhanced NK cell cytotoxicity by regulating the ERK/MAPK signaling pathway (Lee et al., 2022). Additionally, ginsenoside F1 has been found to enhance cancer surveillance by NK cells through an insulin-like growth factor-1-dependent mechanism (Kwon et al., 2018). It should be noted that these studies used saponin doses higher than 23.6 mg/kg, the saponin level present in 200 mg of PSEFS. Thus, enriched resveratrol may be the main reason for PSEFS-induced NK cell activation, while saponins may exert an additive effect.

Resveratrol has been the focus of extensive research, and its efficacy has been investigated in mouse models over the past decades. For example, when administered at a dose of 10 mg/kg daily for 28 days in a xenograft tumor model with HeLa cells, resveratrol substantially reduced the tumor weight (Zhao et al., 2019). In our study, oral intake of PSEFS led to an increase in the splenic NK cell population, accompanied by the augmentation of NK cell function. Similar to our findings, an aqueous Panax ginseng extract induced specific activation of NK cells in C57BL/6 mice (Takeda and Okumura, 2015), suggesting the health supplement possibly induces IFNγ-dependent NK cell activation. Given the role of NK cells in immune surveillance against tumors and virus-infected cells in the body, we believe that PSEFS could be beneficial in patients with diseases where NK cell augmentation is required. Additionally, PSEFS has been shown to exert beneficial effects on BPH, similar to finasteride (Song et al., 2020) and resveratrol (Chung et al., 2015; Li et al., 2019), suggesting its possible application in diseases.

In conclusion, we demonstrated that PSEFS, a health supplement, can improve the cytolytic function of NK cells. Thus, PSEFS could enhance the beneficial effects of resveratrol in vivo via NK cell activation.

We thank Drs. Bae-Whan Kim and Won-Ryong Kim from Resvera Co., Ltd. for providing the PSEFS and composition analysis reports.

This work was supported by the National Research Council of Science & Technology (NST) Aging Convergence Research Center (CRC22013-300), the Korea Research Institute of Bioscience and Biotechnology (KRIBB) Research Initiative Program (KGM5502423), a grant from the Ministry of Food and Drug Safety in 2024 (RS-2024-00332647), and a grant from the Manufacturing Human Cell-based Artificial Blood and Platform Technology Development for Transfusion funded by the Multi-Ministerial Research Project (RS-2023-KH140699).

H.C., S.H.B., and J.-Y.N. designed and performed the experiments and wrote the manuscript. E.S., T.P., J.K., and H.Jeong helped with the in vivo experiments, and H.Jung and S.R.Y. provided helpful discussions.