Small interfering RNA (siRNA) consists of a double-stranded RNA, including a passenger (sense) strand and a guide (antisense) strand, each approximately 19-23 base pairs in length with 3’ dinucleotide overhangs (Friedrich and Aigner, 2022). Typically, synthetic exogenous siRNAs are delivered to cells via liposomes, electroporation, or conjugation with fatty acids or other moieties. Once inside the cell’s endosome, siRNA must escape into the cytoplasm and integrate into the RNA-induced silencing complex (RISC). The siRNA is activated by removing the passenger strand, while the guide strand directs the RISC to bind to the target mRNA in a sequence-specific manner and degrade it (Hu et al., 2020). This mechanism depends on complete nucleotide complementarity binding to the target region of mRNA. After degrading the mRNA, the guide strand dissociates from the RISC and seeks another mRNA target to bind and degrade, acting in a catalytic fashion (Hu et al., 2020; Friedrich and Aigner, 2022).

In addition to 100% complementarity binding-mediated degradation of target mRNAs, siRNAs can also bind to target and nontarget mRNAs via partial complementarity, resulting in translational repression and off-target effects. These effects can be caused by both sense and antisense strands and necessitate mechanisms to mitigate the seed-mediated off-target effects of siRNAs. Several strategies can reduce these off-target effects, including the design of asymmetric siRNAs (asiRNAs), modification of ribose sugars, and pooling multiple siRNAs targeting the same mRNA (Biscans et al., 2020a). Since off-target effects are sequence specific, reducing the concentration of each siRNA can help attenuate the off-target activity of individual siRNAs. Thus, determining the minimum concentration that does not induce off-target effects is essential.

The use of asiRNAs offers many benefits, including the reduction of passenger strand seed-mediated off-target effects, the possible enhancement of passive cellular uptake, and the recognition of asiRNA overhangs by the RISC (Biscans et al., 2020a). Modifications such as 2’-O-methyl (2’-Ome), 2’-fluoro (2’-F), phosphorothioate (PS), and 5’-(E)-vinylphosphonate (VP) can enhance the potency of siRNAs, protect them from nuclease degradation and reduce off-target effects (Adams et al., 2018; Alshaer et al., 2021).

A major hurdle in the clinical development of siRNA-based drugs is the lack of a proper delivery system. Recently, various siRNA delivery systems have been used in clinical applications, especially for targeting liver diseases. Although the delivery system for liver diseases has been resolved, the delivery of siRNA to extrahepatic tissues remains a challenge. Previous reports have shown that docosanoic acid (DCA)-conjugated asiRNAs are superior in terms of safety and knockdown efficacy (Biscans et al., 2020a). Systemic administration of DCA-conjugated asiRNAs at a dose of 100 mg/kg was safe and durable for more than a month, achieving 55% knockdown efficacy (Biscans et al., 2020b).

Breast cancer is a highly heterogeneous disease that is broadly classified into four major subtypes: luminal A, luminal B, Her2 enriched, and TNBC (Orrantia-Borunda et al., 2022). TNBC constitutes ~20% of all breast cancer subtypes and lacks both hormone receptor and Her2 expression. It is the most prevalent subtype among women under 40 years of age and African-American women (Yin et al., 2020). c-MYC (so called MYC) expression is disproportionately elevated in TNBC compared to other subtypes (Horiuchi et al., 2012). Analysis of 945 breast invasive carcinoma samples for copy number alterations (CNAs) revealed that 15.6% (147/945) of the samples exhibited MYC amplification. Among the subtypes, the highest rate of MYC amplification was recorded in TNBC patients (35.7%, 61/171), followed by Her2-positive patients (23.1%, 18/78), luminal B patients (16.2%, 32/197), and luminal A patients (7.2%, 36/499) (Hoadley et al., 2018; TCGA, 2018).

In this study, we aimed to target the MYC oncogene using asymmetric siRNA in TNBC cell lines both in vitro and in vivo. We investigated the effect of MYC knockdown on the expression of downstream genes involved in DNA repair pathways, including RAD51, PARP1 and RRM2. Additionally, we developed novel asiRNAs targeting MYC along with design platforms and validated modification patterns that could be applied to other gene targets. We confirmed the in vivo knockdown efficacy and safety of asiRNA-VP-DCA in tumor xenograft models.

siRNA design

siRNAs were designed using the freely available software siDirect v2.0 (Naito et al., 2004, 2009), employing a combination of three algorithms (Amarzguioui and Prydz, 2004; Reynolds et al., 2004; Ui-Tei et al., 2004). Further screening was performed for additional characteristics, including seed-duplex stability (Tm≤21.5), specificity, contiguous G’s or C’s constraint (<4), and GC content (30-60%). Additionally, a BLAST search was conducted to ensure target specificity. All the self-designed siRNAs were synthesized by GenePharma, Zhangjiang Hi-Tech Park, Shanghai, China. The siRNAs were reconstituted in DEPC-treated water and stored in aliquots at –80°C. Negative control siRNAs were used either from commercial sources or were self-designed. Scramble and mismatch control siRNA/asiRNA sequences were designed by using GenScript Biotech (Genescript, 2021) and computational resources for drug discovery (CRDD, 2021) online tools, respectively. Vinylphosphonate (VP)-modified asiRNA and VP-modified asiRNA with docosanoic acid (DCA) conjugation were synthesized by AXOLABS nucleic acid therapeutics (Kulmbach, Germany).

Cell lines and culture conditions

The triple-negative breast cancer cell lines MDA-MB-157, MDA-MB-231, MDA-MB-436 and Hs-578T were obtained from the Korean Cell Line Bank and used immediately. Prior to use, all cell lines were tested for mycoplasma contamination using the CycleavePCR™ Mycoplasma Detection Kit (#CY232, TaKaRa Bio Inc., Shiga, Japan). MDA-MB-157, MDA-MB-231, and MDA-MB-436 cells were cultured in RPMI 1640 medium (#LM 011-01, WELGENE, Gyeongsan, Korea), while Hs-578T cells were cultured in DMEM supplemented with high-glucose Dulbecco’s modified Eagle’s medium (#001-05, WELGENE). Both media were supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 μg/mL streptomycin. All cultures were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2.

siRNA transfection

A total of 1.5-2×10⁵ cells were seeded in each well of a six-well plate and cultured overnight at 37°C and 5% CO₂. The following day, upon reaching 60-80% confluency, the cells were washed with phosphate-buffered saline (PBS), and the medium was replaced. The transfection mixture was prepared by combining 200 μL of Opti-MEM™ I Reduced Serum Medium (#319850620, Thermo Fisher Scientific, Carlsbad, CA, USA), 5-7 μL of Lipofectamine™ 3000 (#L3000015, Invitrogen, Carlsbad, CA, USA) or DharmaFECT 1 (#T-2001-03, Horizon Discovery, Cambridge, UK), and 2 μL of 20 μM siRNA solution in a 1.5 mL Eppendorf tube. The mixtures were incubated for 15 min at room temperature with Lipofectamine™ 3000 and for 20 min with DharmaFECT 1 (#T-2001-03, Horizon Discovery). Following incubation, 207-209 μL of the transfection mixture was added to the corresponding wells of the six-well plates. The plates were then incubated for 48-72 h at 37°C and 5% CO2.

Water soluble tetrazolium salt (WST-1) assay

Cells were cultured in six-well plates and treated with specific siRNAs. The plates were incubated at 37°C and 5% CO2 for 48-72 h. Following the incubation period, the culture medium in each well was replaced with 1800 μL of fresh medium. Subsequently, 200 μL of EZ-Cytox cell viability reagent (#EZ-3000, Doogenbio Co., Ltd., Suwon, Korea) was added to each well. The plates were then incubated for an additional 3 h at 37°C. After incubation, 100 μL of the medium from each well was carefully transferred to the corresponding wells of a 96-well plate, and the assay was performed at least in duplicate. The absorbance was measured at a wavelength of 450 nm using a SpectraMAX M5 Multi-Reader (Molecular Devices, San Jose, CA, USA). The data were analyzed in Excel, with all treatment groups normalized to either nontreated or mock or negative control (scramble) siRNA.

Cell lysis, protein quantification and western blotting

Cell lysis was performed using RIPA lysis buffer (#89901, Thermo Fisher Scientific, San Francisco, CA, USA) supplemented with Halt™ Protease and Phosphatase Inhibitor Cocktail (100×) (#78440, Thermo Fisher Scientific). Protein concentrations were determined by Pierce™ BCA Protein Assay Kits (#23225, Thermo Fisher Scientific). The cell lysates were resuspended in 5x SDS‒PAGE loading buffer (#SF2002-110-00, Biosesang, Yongin, Korea) and distilled water and then heated at 95°C for 5 min.

The protein lysates were resolved by 10-12% SDS‒PAGE. Each gel was loaded with 20-35 µg of protein and electrophoresed for 20 min at 80 volts through the stacking gel, followed by approximately 90 min at 100 volts through the separating gel. Proteins were transferred to a 0.2 µm polyvinylidene difluoride (PVDF) membrane at 100 volts for 90 min using 5.8 g of Trizma^® base transfer buffer (#T1503-1KG, Sigma‒Aldrich, St. Louis, MO, USA), 29 g of glycine (#01194-00, Samchun Chemicals Co., Ltd., Seoul, Korea), 400 mL of 99.5% methyl alcohol (#M0585 Samchun Chemicals. Co., Ltd.), and distilled H₂O to make 2 liters. Blocking was performed with 5% skim milk (#232100, BD Biosciences, Sparks, MD, USA) in 1× TBST for 30 min on a shaker at room temperature. Primary and secondary antibodies were diluted within the recommended ranges in 1% skim milk with 1× TBST. After blocking, the membrane was washed once, and primary antibodies were applied and incubated overnight at 4°C on a shaker. The membranes were then washed three times for 10 min each for a total of 30 min while shaking. The membranes were incubated with secondary antibodies for 2 h at room temperature on a shaker. Subsequent washes involved three cycles of 10 min each in 1× TBST, totaling approximately 30 min. Image documentation was performed by an LAS4000 instrument (ImageQuant, GE Healthcare, Hertfordshire, UK) using chemoluminescence, with the help of detection reagent A (#RPN2232S1: luminol enhancer solution from GE Healthcare) and reagent B (#RPN2232S2: peroxide solution from GE Healthcare), which were mixed at a ratio of 1:1.

The following primary antibodies were used: recombinant anti-c-MYC antibody [Y69] (#ab32072, Abcam, Cambridge, MA, USA), anti-beta actin antibody (#ab8227, Abcam); anti-GAPDH antibody [EPR16891] as a loading control (#ab181602, Abcam), anti-RAD51 antibody ([EPR4030(3)] (#ab133534, Abcam), PARP1 (46D11) rabbit mAb (#9532, Cell Signaling Technology, Danvers, MA, USA) and RRM2 (E7Y9J) XP^® rabbit mAb (#65939, Cell Signaling Technology). The secondary antibody used was goat anti-rabbit IgG H&L (HRP) (#ab205718, Abcam).

RNA purification, cDNA synthesis and reverse transcriptase quantitative PCR (RT-qPCR)

Total RNA was isolated from cell lines and tissues using Hybrid-R^TM (#305-101, GeneAll Biotechnology, Seoul, Korea) with RiboEx^TM lysis. The concentration of total RNA was determined by measuring the absorbance at 260 nm (A₂₆₀) using a NanoDrop device (Thermo Fisher Scientific). The purity of the RNA was assessed by the A₂₆₀/A₂₈₀ ratio. For cDNA synthesis, 1 μg of total RNA was reverse transcribed using a RevertAid First Strand cDNA Synthesis Kit (#K1622, Thermo Fisher Scientific). The master mix for reverse transcription included 1 μL of a mixture of Oligo (dT)18 and random hexamer primers. This mixture (2 μL) was added to each RNA sample tube. The RNA samples were denatured at 65°C for 5 min and then allowed to anneal at 40°C for 5 min. The second component of the master mix was prepared by combining 4 μL of 5× reaction buffer, 1 μL of RiboLock RNase inhibitor, 2 μL of 10 mM dNTP mix, and 1 μL of RevertAid M-MuLV RT (200 U/μL), totaling 8 μL per sample. The reaction conditions were set on a TaKaRa Thermal Cycler Dice Touch (TaKaRa Bio Inc., Shiga, Japan) at 25°C for 5 min, 42°C for 1 h, and 70°C for 5 min, followed by a hold at 4°C.

qPCR was conducted using TOPreal^TM SYBR Green qPCR 2X PreMIX with low ROX (#RT500M, Enzynomics, Daejeon, Korea) on a 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA; Thermo Fisher Scientific). Primers were designed using the PrimerQuest™ Tool available on the Integrated DNA Technologies (IDT, Coralville, IA, USA) website, as detailed in Table 1. The qPCR protocol was as follows: initial denaturation at 95°C for 12 min, followed by 45 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 15 s, and elongation at 72°C for 15 s. HPRT1 served as the endogenous control for normalization. Ct values were analyzed using the delta-delta Ct (2^{^−ΔΔCq}) method (Livak and Schmittgen, 2001).

Table 1 Primers used for mRNA quantification by qPCR

	Gene name	Primers	(5'→3')
1	PARP1	Forward primer	GGA TCA GGG TGT AAA AGC GAT
		Reverse primer	CGC ATA CTC CAT CCT CAG TG
2	MYC	Forward primer	TCT TCC TCA TCT TCT TGT TCC TC
		Reverse primer	TCC TCG GAT TCT CTG CTC TC
3	RAD51	Forward primer	ACA TTA TCC AGG ACA TCA CTG C
		Reverse primer	GCC ATG TAC ATT GAC ACT GAG
4	HPRT1	Forward primer	GCG ATG TCA ATA GGA CTC CAG
		Reverse primer	TTG TTG TAG GAT ATG CCC TTG A
5	RRM2	Forward primer	TCTTGCATTGTGAGGTACAGG
		Reverse primer	TCTGAGCTGGCAGAAGTTAATC

Serum stability study

To assess the serum stability of the siRNAs, 6 μL of 20 μM siRNA (~1.5 μg) was incubated in 8 μL of 100% fetal bovine serum (FBS) as described previously (Jung et al., 2015). The stability assay was conducted at 0 h, 2 h, 6 h, 12 h, 24 h, and 48 h. After each time interval, siRNA samples were collected and stored at –70°C. For analysis, the samples were heated at 70°C for 10 min in a thermocycler and then immediately chilled on ice for 3 min. Subsequently, 3 μL of DNA loading dye was added to each sample. A 100 bp DNA ladder was used as a marker. Finally, 15 μL of the resulting mixture was loaded onto a 1.5% agarose gel and electrophoresed at 135 volts for 15 min. Gel imaging was conducted using a Bio-Rad Gel Doc EZ Imager Documentation (DE, USA).

Tumor xenograft model

All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Seoul National University (SNU-210721-1). In this study, 6-week-old female BALB/c-nude mice were housed in ventilated cages with ad libitum access to food and water, a 12 h light/dark cycle, and controlled temperature and humidity in an animal facility. Tumor xenografts were generated by subcutaneously (SC) injecting 100 μL of 6.5×10⁶ MDA-MB-231 cells prepared in 50 μL of serum-free RPMI 1640 (#LM 011-01, WELGENE) mixed with 50 μL of BD Matrigel matrix at a high concentration (#354248, BD Biosciences, Plymouth, UK) in the right flank of 14 mice. Once the tumor diameter reached greater than 300 mm³, the mice were administered a single dose of 20 mg/kg asiRNA-VP-DCA, scramble asiRNA-VP-DCA or the same volume of PBS via the SC route. Mice were euthanized on days 2, 7, 14, and 28 post-injection, and tumor tissues were collected in a cryovial and preserved in RNAlater™ Solution (RNA stabilization solution, #AM7020, Invitrogen, Vilnius, Lithuania) for RT‒qPCR analysis or snap-frozen in liquid nitrogen for western blot analysis. Both western blotting and qPCR experiments were conducted as described for the in vitro experiments.

In addition, 20 BALB/c nude mice were injected SC in the right flank of MDA-MB-231 cells to investigate the long-term knockdown effects of repeated doses. Once the tumor volume exceeded 150 mm³, the mice were randomly assigned to one of 4 groups: PBS (SC), asiRNA-VP-DCA (SC), scramble-asiRNA-VP-DCA (SC), and asiRNA-VP-DCA (IT). Mice received injections of 100 μL of either PBS (SC) or 100 μL of 15 mg/kg asiRNA-VP-DCA (SC) targeting MYC, scramble asiRNA-VP-DCA (SC) as a negative control, or 50 μL asiRNA-VP-DCA (IT) targeting MYC at days 1, 3, 6 and 10. After 46 days of treatment, the mice were euthanized, and tumor tissues were collected, snap frozen in liquid nitrogen, and stored at –70°C for subsequent analysis of MYC and PARP1 protein expression by western blotting.

Statistical analysis

Data analysis was performed using GraphPad Prism version 8.0.2 software (Dotmatics, Boston, MA, USA). One-way and two-way ANOVA with Tukey’s and Sidak’s multiple comparisons tests were used to determine the significance level between treatment groups. The IC₅₀ curves were fitted using log (inhibitor) versus normalized response with variable slope. In all cases, the significance level was set at the 95% confidence interval with *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

siRNA screening, asiRNA design, modification and conjugation

Prototype siRNA design (19+2/19+2): A total of 12 siRNAs targeting the MYC oncogene were designed using siDirect v2.0 online software (Fig. 1A). Initially, these siRNAs were evaluated for their ability to knock down MYC mRNA and protein levels. Only siRNAs that achieved a greater than 50% reduction in mRNA levels in at least one cell line were selected for further optimization. This optimization involved adjusting the siRNA dosage, the volume and type of transfection reagent, and the number of cells used.

Figure 1. siRNA nomenclature, modification types and patterns, and conjugating compound illustration. (A) The prototype siRNA design structure (19+2/19+2). (B) Alternate fully modified siRNA with 2’-Ome + 2’-F, (C) 2’-Ome + 2’-F + PS, (D) 2’-Ome + 2’-F + PS and ChoL conjugated at the 3’ end of the passenger strand. (E-O) Unmodified asymmetric siRNAs with different lengths of passenger and guide strands. (P) Alternate fully modified asymmetric siRNA with 2’-Ome + 2’-F + PS + VP. (Q) Alternate fully modified asymmetric siRNA with 2’-Ome + 2’-F + PS + VP + DCA conjugation. (R) Asymmetric siRNA with reduced 5’ end- and -2’- fluoro modification design (19+2/16+2). (S) Asymmetric siRNA with reduced 5’ end- and -2’- fluoro modification design (19+2/13+2). The modified siRNA and asiRNA were conjugated with either ChoL or DCA at the 3’ end of the sense strand with noncleavable (highlighted in the green curved line) and cleavable linkers (highlighted in the purple curved line), respectively. The asiRNAs were selected based on their in vitro knockdown efficacy and then fully modified to reduce off-target effects and enhance nuclease stability. asiRNA: asymmetric siRNA, the number next to each siRNA/asiRNA indicates their identity based on the structural design, mf: alternate modification by 2’-Ome and 2’-F, PS: phosphorothioate modified, VP: 5’-(E)-vinylphosphonate, ChoL: cholesterol, DCA: docosanoic acid, asiRNA-VP and asiRNA-VP-DCA were derived from the parent siRNA10 to asiRNA10-3 and then modified and conjugated. Notes: Different asiRNAs can have the same structural design and sequence length; for example, Mod_asiRNA8-4 and Mod_asiRNA12-1 have the same structural design. An illustration was created with BioRender.com, and the chemical structures were generated with ChemDraw 20.1 (PerkinElmer, Waltham, MA, USA).

After the initial screening, to enhance serum stability, potency, safety, and durability, one siRNA candidate, referred to as siRNA8, was selected for further modifications. These modifications and conjugations include 2-Ome + 2’-F (Fig. 1B), 2’-Ome + 2’-F + PS (Fig. 1C), and 2’-Ome + 2’-F + PS + ChoL conjugation at the 3’ end of the passenger strand using a noncleavable linker (triethylene glycol) (Fig. 1D).

Asymmetric siRNA design: To mitigate seed-mediated off-target effects and enhance specificity, we systematically designed a series of asiRNAs by progressively shortening the passenger strand. Starting with a standard 19+2 nucleotide configuration on the guide strand, we reduced the length of the passenger strand by one nucleotide, resulting in configurations such as 19+2/18+2 (Fig. 1E), 19+2/17+2 (Fig. 1F), 19+2/16+2 (Fig. 1G), 19+2/15+2 (Fig. 1H), 19+2/14+2 (Fig. 1I), and 19+2/13+2 (Fig. 1J).

Additionally, to explore the impact of eliminating the 2’-overhang on the passenger strand, we designed configurations such as 19+2/16+0 (Fig. 1K), 19+2/15+0 (Fig. 1L), and 19+2/15+0, with further modifications by removing one nucleotide from the 5’ end and five nucleotides from the 3’ end of the passenger strand, as depicted in Fig. 1M.

Furthermore, because shorter asiRNAs may further minimize off-target effects, we synthesized an asiRNA with an overall length of 20 nucleotides. These included 18+2/15+2 (Fig. 1N) and 18+2/15+0 (Fig. 1O).

Modified and conjugated asymmetric siRNA design: Following the initial screening of various asiRNAs for their MYC knockdown efficacy, the 19+2/16+2 design was selected for further modifications, including 2’-Ome + 2’-F + PS + VP (Fig. 1P). This modified asiRNA was then validated for its in vitro knockdown efficacy. For in vivo evaluation, asiRNA-VP was conjugated with DCA at the 3’ end of the passenger strand for systemic delivery using a cleavable phosphodiester linker [dTdCdA- HC6: aminohexyl linker] (Fig. 1Q).

While the extensive modification of siRNA is typically advantageous for enhancing nuclease resistance and ensuring durable efficacy, heavy modifications at the 5’ end (e.g., a combination of 2’-Ome or 2’-F with PS) and a high proportion of 2’-F modifications have occasionally led to interference and long-term toxicity, respectively.

Given these challenges and considering that 2’-Ome modifications are known to be more stable than 2’-F modifications, we developed additional modification strategies. These included reducing the modifications at the 5’ end of the guide strand (specifically omitting PS modifications) and decreasing the overall number of 2’-F modifications. These adjustments aim to reduce off-target effects and long-term toxicity associated with fluorine modifications while enhancing the nuclease stability of 2’-Ome over 2’-F modifications (Fig. 1R, 1S).

siRNA8 and siRNA10 showed consistent knockdown efficacy

Initial screenings were conducted using MDA-MB-157, MDA-MB-231, and MDA-MB-436 cells, each treated with 20 nM siRNA. Twelve siRNAs were evaluated for their ability to knockdown mRNA and protein expression (Fig. 2A-2C). siRNA7 through siRNA12 achieved greater than 50% mRNA knockdown efficacy in at least one of these cell lines (Fig. 2B) and were selected for further analysis. In contrast, siRNA1 through siRNA6 were excluded from subsequent tests due to insufficient efficacy.

Figure 2. siRNA screening based on the knockdown efficacy of MYC mRNA and protein in the MDA-MB-157, MDA-MB-231 and MDA-MB-436 cell lines. (A) The relative mRNA expression of MYC in the MDA-MB-436 cell line treated with 20 nM of siRNA1 to 12 (S1 to S12). (B) The relative mRNA expression of MYC in the MDA-MB-157 cell line treated with 20 nM S1 to S12. (C) Immunoblotting of MYC protein in MDA-MB-157, MDA-MB-436 and MDA-MB-231 cells treated with 20 nM S1 to S12. (D) Efficiency of S7 to S12 knockdown in the MDA-MB-157 cell line. (E) Comparison of the effects of Lipofectamine™ 3000 reagent volume (5 µL versus 6 µL) on the MDA-MB-436 cell line treated with 20 nM S7 or S12. (F) Cell number versus transfection reagent (DharmaFECT 1) volume for the MDA-MB-157 cell line treated with 20 nM siRNA10. (G) Relative mRNA levels of MYC after 24, 48 and 72 h of treatment with 20 nM siRNA in the MDA-MB-157 cell line. (H) Immunoblotting of MYC after 24, 48 and 72 h of treatment with 20 nM siRNA in the MDA-MB-157 cell line. NT: nontreated control, Mock: transfection reagent control, NG: scramble siRNA, S: siRNA. MYC mRNA expression was normalized to that of the endogenous control HPRT1. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, and ns: nonsignificant. All mRNA expression data were done in triplicate (n=3).

Further screening via western blotting revealed that siRNA8 and siRNA10 had superior knockdown efficacy across all three cell lines (Fig. 2C), indicating that western blotting provided more specific results than mRNA quantification at this screening stage. Various factors, including the dose of siRNA, volume of transfection reagent, assay timing post-transfection, and cell count, significantly influenced the knockdown efficiency (Fig. 2D-2H). Specifically, increasing the siRNA dose (Fig. 2D) and the volume of the transfection reagent (Fig. 2E) significantly improved the mRNA knockdown efficacy. Conversely, a greater cell number reduced the efficacy (Fig. 2F), while increasing the volume of DharmaFECT 1 enhanced it (Fig. 2F). Additionally, no significant differences in knockdown efficacy were observed between the DharmaFECT 1 and Lipofectamine™ 3000 transfection reagents in Hs-578T cells (Supplementary Fig. 1). Notably, the knockdown efficacy of siRNAs at both the mRNA and protein levels improved over time; for example, assays conducted 72 h post-treatment showed significantly greater mRNA knockdown in MDA-MB-157 cells than at 24 h (Fig. 2G, 2H).

Alternating full modifications with 2’-Ome, 2’-F and PS enhanced the potency and durability of siRNA

Next, we evaluated the silencing efficacy of modified and/or conjugated siRNA8 derivatives, siRNA8-mf (2’-Ome + 2’-F), siRNA8-mf-PS (2’-Ome + 2’-F + PS), and siRNA8-mf-PS-ChoL (2’-Ome + 2’-F + PS-ChoL), in MDA-MB-157 and Hs-578T cells. Both siRNA8-mf and siRNA8-mf-PS demonstrated knockdown efficacy comparable to that of unmodified siRNA8 and siRNA10 after 72 h (Fig. 3A, 3B). Notably, effective MYC protein knockdown was observed in MDA-MB-157 cells treated with 20 nM siRNA8-mf-PS-ChoL without the use of a transfection reagent, highlighting the potential of ChoL conjugation as a delivery system (Fig. 3B).

Figure 3. Alternating full chemical modifications with 2’-Ome and 2’-F increased the potency, stability and durability of siRNA. (A) The relative mRNA expression of MYC in the MDA-MD-157 cell line treated with siRNA8-modified derivatives and siRNA10 was assayed after 72 h. (B) Immunoblotting of MYC in MDA-MB-157 cells treated with siRNA8-modified derivatives and siRNA10 and assayed after 72 h. (C) The durability of modified and unmodified siRNA8 derivatives on the MDA-MB-157 cell line based on mRNA expression assayed at 3, 6, 9 and 15 days. (D) The relative mRNA expression of MYC in MDA-MB-157 cells treated with 20 nM siRNA8 or siRNA8-mf was assayed on day 9. (E) The relative mRNA expression of MYC in MDA-MB-157 cells treated with 20 nM siRNA8, siRNA8-mf or siRNA8-mf-PS was assayed on day 15. (F) The relative mRNA expression of MYC in Hs-578T cells treated with siRNA-mf-PS-ChoL with or without transfection reagent. (G) Serum stability of siRNA8, siRNA8-mf, siRNA8-mf-PS and siRNA10 in the MDA-MB-157 cell line after electrophoresis on a 1.5% agarose gel. (H) Kinetics of modified and unmodified siRNAs as quantified by ImageJ software (National Institute of Health, Bethesda, MD, USA). The doses of all siRNAs were 20 nM, except for the pooled siRNA (siRNA8 and siRNA10) (10 nM each). NT: nontreated control, Mock: transfection control, Scramble: negative control siRNA, mf: alternate full modification with 2’-Ome and 2’-F, PS: phosphorothioate, ChoL (+): cholesterol-conjugated siRNA8 with transfection reagent and ChoL (-): cholesterol-conjugated siRNA8 without transfection reagent. MYC mRNA expression was normalized to that of the endogenous control HPRT1. *p<0.05, ***p<0.001, ****p<0.0001, and ns: nonsignificant. All the experiments were done in triplicate (n=3).

Further investigation of the long-term knockdown efficacy revealed that the optimal duration ranged from 3 to 9 days or more (Fig. 3C, Supplementary Fig. 2A). This sustained efficacy, along with enhanced potency, was more pronounced in cells treated with siRNA8-mf and siRNA8-mf-PS (Fig. 3C-3E). Specifically, siRNA8-mf exhibited significantly greater knockdown efficacy than siRNA8 on day 9 (p<0.05) (Fig. 3D). On day 15, siRNA8-mf-PS demonstrated significantly greater and more durable knockdown efficacy (69%) than both siRNA8 and siRNA8-mf (p<0.05) (Fig. 3E).

The in vitro transfection and silencing efficacy of ChoL-conjugated siRNAs were also examined. Without transfection reagents, significant knockdown efficacy was observed in Hs-578T cells treated with siRNA8-mf-PS-ChoL (p<0.05) (Fig. 3F). However, at lower doses, the mRNA knockdown efficacy of siRNA8-mf-PS-ChoL in MDA-MB-157 cells was reduced (Supplementary Fig. 2B).

Additionally, the serum stability of the modified siRNAs siRNA8-mf and siRNA8-mf-PS was compared to that of unmodified siRNA8 and siRNA10. The modified siRNAs showed prolonged stability in vitro (Fig. 3G, 3H, Supplementary Fig. 3A-3D).

The knockdown efficacy of asiRNAs is similar to that of symmetric siRNAs

A major drawback of siRNAs is the frequent occurrence of off-target effects. The primary objective in designing the asiRNAs was to reduce seed-mediated off-target effects from the seed region (2-8 bases at the 5’ end). Among the designed asiRNAs, those with greater than 60% knockdown efficiency and at least 3 nucleotides removed at the 5’ end of the passenger strands were selected for further optimization through various modifications. With the exception of 19+2/15+2, 19+2/14+2, 18+2/15+0 and 18+2/15+2 (with dTdT), all other designs, including 19+2/18+2, 19+2/17+2, 19+2/16+2, 19+2/16+0, 19+2/15+0 and 19+2/13+2, showed similar (p>0.05) knockdown efficacy to that of the full-length siRNA (19+2/19+2) (Fig. 4A-4E). In the 19+2/13+2 design platform, 71.5% of the nucleotides in the seed region were removed, yet the knockdown efficacy was similar (p>0.05) to that of 19+2/19+2 (Fig. 4A, 4B, Supplementary Fig. 4A). The knockdown efficacy of siRNA8 (19+2/19+2) was significantly greater than that of 19+2/16+2 on day 3 (Fig. 4C, 4D, Supplementary Fig. 4B), while by day 7, the difference became nonsignificant (p>0.05), indicating enhanced efficacy over time (Fig. 4E).

Figure 4. The knockdown efficacy of asiRNA8, asiRNA10 derivatives, and asiRNA-VP. (A) The relative mRNA, and (B) The protein expression of MYC in the MDA-MB-436 cell line treated with siRNA10 and its asiRNA derivatives was assayed after 3 days. (C) The relative mRNA, and (D). The protein expression of MYC in MDA-MB-436 cells treated with siRNA8 and its asiRNA derivatives was assayed after 3 days. (E) The relative mRNA expression of MYC in the MDA-MB-157 cell line treated with siRNA8 and its asiRNA derivatives was assayed after 7 days. (F) The relative mRNA expression of MYC in MDA-MB-157 cells treated with siRNA10, asiRNA10-3 and asiRNA-VP (at different concentrations). (G) Immunoblotting of MDA-MB-157 cells treated with siRNA10, asiRNA10-3 and asiRNA-VP (at different concentrations). (H) The viability of MDA-MB-157 cells treated with siRNA10, asiRNA10-3 and asiRNA-VP (at different concentrations). (I) Relative mRNA expression versus cell viability after treatment with siRNA10, asiRNA10-3 and asiRNA-VP (at different concentrations). (J) The IC₅₀ of asiRNA-VP, asiRNA10-3 and siRNA10. asiRNA-VP: asymmetric siRNA with alternate full modification by 2’-Ome, 2’-F, PS, and VP at the 5’ end. The number labels, for example, 19+2/19+2, 19+2/16+2, etc., indicate the number of nucleotides present on the guide and passenger strands with a 2-nucleotide overhang. The dose of all siRNAs and asiRNAs, including the scrambled (negative control) siRNA, was 20 nM unless otherwise specified. MYC mRNA expression was normalized to that of the endogenous control HPRT1. **p<0.01, ***p<0.001, ****p<0.0001, and ns: nonsignificant. All the experiments were done in triplicate (n=3).

Among the asiRNAs used in this study, 19+2/16+2 (asiRNA10-3) and 19+2/13+2 (asiRNA10-6) were selected for further optimization and implementation of different modification patterns to enhance knockdown efficacy. Full modification of asiRNA10-3 with 2’-Ome, 2’-F, PS and VP enhanced the knockdown efficiency compared to that of the unmodified siRNAs (Fig. 4F, 4G). Compared with unmodified asiRNA10-3, fully modified asiRNA-VP increased the knockdown efficacy by 19% (Fig. 4F, 4G) and amplified the potency by 7.7-fold (Fig. 4J). MYC protein knockdown efficacy was greater in cells treated with 1 nM asiRNA-VP than in those treated with 20 nM unmodified asiRNA10-3 (Fig. 4G). This difference was also reflected in the IC₅₀ prediction results (Fig. 4J). The knockdown efficacy of asiRNA-VP remained robust even at a lower dose (1 nM). Moreover, compared with unmodified asiRNA10-3, asiRNA-VP not only demonstrated increased potency but also induced enhanced cell death (Fig. 4H, 4I). Additionally, scramble and mismatch control siRNAs, designed from the parent siRNA10, were validated for their lack of effect on mRNA and protein expression, as well as cell viability. Neither the scramble nor the mismatch control siRNA significantly decreased (p>0.05) MYC mRNA or protein levels compared to those in the siRNA8, siRNA10, and asiRNA10-3 groups (Supplementary Fig. 4C, 4D). Furthermore, the difference in cell viability between nontreated cells and those treated with either scramble or mismatch siRNAs was negligible (Supplementary Fig. 4E), indicating their safety and reduced off-target effects.

Reduced 5’ end- and -2’- fluoro modification design

Alternate modifications involving equal proportions of 2’-Ome and 2’-F may not always yield beneficial outcomes. For example, the 2’-F modification tends to be less stable than 2’-Ome. Additionally, antisense oligonucleotides modified with 2’-F have shown greater affinity for binding to cellular proteins than those modified with 2’-Ome, leading to interference with protein folding due to increased hydrophobicity, which can result in toxicity (Shen et al., 2018). Conversely, in the case of asiRNA-VP, the 5’ end of the guide strand was extensively modified with PS, 2’-Ome, and 2’-F, which often led to off-target effects (Parmar et al., 2016). To address these issues, we designed a modification strategy to reduce the 5’ end modification burden and the extent of overall 2’-F modification while increasing the 2’-Ome modification. This new design was applied to Mod_asiRNA8-4, Mod_asiRNA12-1 (Fig. 1R), and Mod_asiRNA10-6 (Fig. 1S), and their knockdown efficacy on MYC and its downstream target genes was assessed (Fig. 5A-5D, 5F, 5G). In particular, compared with the control, Mod_asiRNA10-6 significantly downregulated RRM2, RAD51, and PARP1 protein expression, especially in MDA-MB-231 cells (Fig. 5F, 5G). Additionally, MYC protein downregulation by Mod_asiRNA12-1 was found to be cell line dependent, with a significant effect observed in MDA-MB-157 cells but less so in MDA-MB-231 cells (Fig. 5F, 5G). On the other hand, knockdown of MYC mRNA by Mod_asiRNA8-4 resulted in slight overexpression of RRM2 but not RAD51 (Fig. 5B, 5C). Among all the tested modifications, Mod_asiRNA10-6 induced the most cell death (Fig. 5E, 5H). Interestingly, both Mod_asiRNA10-6 and Mod_asiRNA12-1 triggered transient overexpression of MYC mRNA, similar to asiRNA-VP, but did not affect the protein levels.

Figure 5. Mod_asiRNA10-6 was more efficient at downregulating MYC, RRM2, RAD51 and PARP1 than the other siRNAs. (A) The relative mRNA expression of MYC, (B) RRM2, (C) RAD51 and (D) PARP1 in the MDA-MB-231 cell line. (E) The viability of the MDA-MB-231 cell line. (F) The immunoblots of MYC, RRM2, RAD51 and PARP1 in MDA-MB-231 cells and (G) MDA-MB-157 cell lines. (H) The viability of MDA-MB-157 cell line. For the modification patterns of each asiRNA used, refer to Fig. 1C, 1R, 1R and 1S. The dose of all siRNAs was 20 nM. Scramble: negative control asiRNAs (stabilized by modifications similar to those of the target asiRNAs). The relative mRNA expression of MYC was normalized to that of the endogenous control, HPRT1. ***p<0.001, ****p<0.0001, and ns: nonsignificant. All the experiments were done in triplicate (n=3).

Knockdown of MYC by high doses of heavily modified siRNAs, such as Mod_asiRNA10-6 and Mod_asiRNA12-1, in the MDA-MB-231 cell line induced either MYC overexpression or an unperturbed response when treated with siRNA8-mf-PS. Moreover, MYC overexpression was observed in MDA-MB-231 cells treated with asiRNA-VP (Supplementary Fig. 5A). We aimed to investigate differences in siRNA sequence, dose and modification type rather than the target genes affected. Various unmodified and modified siRNAs, including siRNA10, asiRNA10-3, asiRNA-VP (at different concentrations), siRNA8, siRNA8-mf, and siRNA8-mf-PS, were tested to determine whether they could induce MYC mRNA overexpression. We found that MYC mRNA overexpression was dependent on the siRNA sequence, modification type, and dosage (Supplementary Fig. 5A-5J). Knockdown of MYC using either asiRNA-VP or siRNA8-mf-PS effectively downregulated MYC and its downstream target proteins (RRM2, RAD51, and PARP1) regardless of the dose (Supplementary Fig. 5F, 5K), indicating the transient nature of MYC mRNA overexpression. Knockdown of MYC by siRNA8, siRNA8-mf, siRNA10, or asiRNA10-3 efficiently downregulated MYC mRNA and protein expression (Supplementary Fig. 5A, 5G, 5F, 5K). The overexpression of MYC mRNA in response to asiRNA-VP treatment decreased in a dose-dependent manner; for instance, at a dose of 0.75 nM (approximately its IC₅₀), MYC mRNA was downregulated by 55.5% (Supplementary Fig. 5A). Therefore, the overexpression of MYC mRNA was caused by a high dose of heavily modified siRNA/asiRNA at the 5’ end of the guide strand in a cell type- and sequence-specific manner, since this phenomenon was also observed in cells treated with Mod_asiRNA10-6 and Mod_asiRNA12-1 but not in cells treated with Mod_asRNA8-4.

Treatment of mouse tumor xenografts with asiRNA-VP-DCA downregulated MYC mRNA and protein

To investigate the in vivo knockdown efficacy of asiRNAs, asiRNA-VP was conjugated to DCA for extrahepatic delivery. Previous studies reported that DCA-conjugated asiRNAs demonstrated superior knockdown efficacy in extrahepatic tissues compared to those conjugated with ChoL and docosahexaenoic acid (Biscans et al., 2020b). To investigate the in vivo knockdown efficacy of asiRNA-VP-DCA, MDA-MB-231 cells were subcutaneously (SC) injected into BALB/c nude mice. Once the tumors reached a volume of 150 mm³ or more, the mice were treated with either a single 400 µg dose or four repeated 300 µg doses of asiRNA-VP-DCA via the SC or IT route (Fig. 6A). The mice were subsequently sacrificed on predetermined days, as illustrated in Fig. 6A. Tumor tissue samples were snap frozen for protein detection or preserved in RNAlater for mRNA quantification.

Figure 6. Knockdown of MYC mRNA and protein was observed in BALB/c nude mouse tumor xenografts treated with asiRNA-VP-DCA. (A) MDA-MB-231 cell tumor xenograft treatment groups are shown in Group I: Single-dose treatment (400 μg) was used to investigate the knockdown effect over time, and Group II: 300 μg of asiRNA-VP-DCA (targeting MYC) was injected 4 times via either the SC or IT route. (B) The relative mRNA and (C) protein expression of MYC in MDA-MB-231 cell line xenograft mice treated with 400 μg of asiRNA-VP-DCA dissolved in 100 µL of PBS via a single-dose SC route. (D) Immunoblotting of MYC and PARP1 from mouse tumor xenografts after 4 repeated injections of 100 µL of PBS, 300 μg of the target asiRNA-VP-DCA (SC), 300 μg of the scramble asiRNA-VP-DCA (SC) or 300 μg of the target asiRNA-VP-DCA via the intratumoral (IT) route. Scramble or scram refers to scramble asiRNA-VP-DCA (negative control asiRNA with similar modification types/patterns and conjugation but differing in nucleotide sequence), and asiRNA-VP-DCA targets MYC mRNA. The relative mRNA expression of MYC was normalized to that of the endogenous control HPRT1. An illustration was created with BioRender.com. All the experiments were done in triplicate (n=3).

The results showed efficient knockdown of MYC mRNA and protein in the mouse xenograft model treated with a single dose of asiRNA-VP-DCA (Fig. 6B, 6C). However, variability in response to treatment was evident, affecting both mRNA and protein levels. In the group receiving four repeated doses of asiRNA-VP-DCA, either SC or IT, knockdown of the MYC protein was still detectable after 46 days of treatment (Fig. 6D), confirming the sustained efficacy of fully modified asiRNA-VP-DCA in vivo. This finding aligns with the in vitro results in which MYC knockdown also downregulated the PARP1 protein (Fig. 6D). Importantly, neither the single 400 µg dose nor the 300 µg repeated doses of asiRNA-VP-DCA induced any signs of toxicity or mortality in either treatment group, highlighting the safety profile of asiRNA-VP-DCA.

In this study, we designed siRNAs targeting the MYC oncogene, as illustrated in Fig. 1A, and screened for preliminary knockdown efficacy across cell lines, including MDA-MB-157, MDA-MB-231, MDA-MB-436 and Hs-578T. Among the 12 siRNAs tested, siRNA8 and siRNA10 demonstrated consistent and efficient knockdown of MYC at both the mRNA and protein levels, regardless of the cell type, cell number, transfection reagent volume, siRNA dosage, and assay time post-treatment (Fig. 2A-2H). To enhance nuclease resistance, reduce toxicity, and increase potency, siRNAs are stabilized through various ribose sugar modifications. Specifically, siRNA8 was modified with 2’-Ome, 2’-F, and PS (Fig. 1B, 1C). Additionally, ChoL was conjugated to siRNA8-mf-PS, which served as a delivery system instead of a transfection reagent (Fig. 1D). Although the knockdown efficacies of siRNA8, siRNA8-mf, and siRNA8-mf-PS in the MDA-MB-157 cell line were similar (p>0.05) after 3 days, significant differences in efficacy (p<0.05) were observed at both 9 and 15 days (Fig. 3A-3E). This indicates an increasing trend in the knockdown efficacy of the modified siRNAs over time compared to that of their unmodified counterparts. Generally, modifications in siRNA structures enhance nuclease resistance, increase potency and efficacy, reduce off-target effects (Hu et al., 2020), and improve siRNA stability in acidic subcellular compartments (Brown et al., 2020).

The mRNA expression levels initially decreased following treatment with unmodified siRNAs and those modified with 2’-Ome or 2’-F but began to increase after 9 days. In contrast, siRNAs modified with PS, specifically siRNA8-mf-PS, maintained their knockdown efficacy longer, demonstrating a slower loss of effect than siRNA8 and siRNA8-mf (Fig. 3C). The prolonged activity of PS-modified siRNAs can be attributed to the increased protein binding affinity conferred by PS modification, which enhances intracellular trafficking and overall potency (Crooke et al., 2020). This suggests that siRNA-mediated knockdown can remain effective, reducing target mRNA levels by more than 50% for up to 15 days in vitro (Fig. 3C). The use of ChoL conjugation for in vivo siRNA delivery has been previously reported (Chernikov et al., 2023). Increasing the dose of ChoL-conjugated siRNA led to a significant decrease of MYC mRNA by 26% in Hs-578T cells without the use of transfection reagents (Fig. 3F).

Serum stability studies further underscored the benefits of siRNA modifications. Compared with their unmodified counterparts, siRNAs modified with 2’-Ome and 2’-F and PS at both 5’ and 3’ ends of the sense and antisense strands exhibited greater stability when incubated with 100% fetal bovine serum (FBS) at 37°C (Fig. 3G, 3H, Supplementary Fig. 3A-3D). Unmodified siRNA8 and siRNA10 were quickly degraded, showing an 80% reduction in just 2 h, with complete degradation occurring within 6 h (Supplementary Fig. 3A, 3D). Conversely, siRNA8-mf and siRNA8-mf-PS demonstrated enhanced serum stability, highlighting the protective effect of these modifications (Supplementary Fig. 3B, 3C).

The primary objective of designing asiRNAs was to minimize off-target effects while maintaining the specific targeting capability of the guide strand. By truncating up to 6 nucleotides from the 5’ end of the passenger strand, our results indicated that the knockdown efficacy was largely unaffected (Fig. 4A, 4B, Supplementary Fig. 4A). This strategy is thought to reduce off-target activity by mitigating unintended global gene downregulation effects (Yuan et al., 2012, Biscans et al., 2020a). Our experiments confirmed the efficacy of several novel asiRNA designs, which could be applied to various siRNAs targeting either the same gene (Fig. 4C-4E) or different target genes. Notably, the 19+2/16+2 design was successfully validated for siRNAs targeting RRM2 (data not shown). Despite the removal of 3-6 nucleotides from the 5’ end of the passenger strand, the asiRNAs maintained their knockdown efficacy.

The seed region of the siRNA can inadvertently affect global gene expression (Biscans et al., 2020a). Interestingly, removing a single nucleotide from the 5’ end of the guide strand greatly reduced its knockdown efficacy (Fig. 4A-4E, Supplementary Fig. 4B). Compared to the 19+2/15+0 design, the 19+2/15+2 design showed minimal knockdown efficacy (Fig. 4A, 4B, Supplementary Fig. 4A), contrary to the notion that adding a 2-nucleotide overhang at the 3’ end enhances RISC loading and knockdown efficacy (Biscans et al., 2020a). By day 7, the differences in efficacy between standard siRNA8 (19+2/19+2) and its asymmetric variant (19+2/16+2) were not statistically significant (p>0.05), highlighting a time-dependent improvement in knockdown performance that aligns with the durability observed in earlier studies (Fig. 3C). This suggests that asiRNA design may offer a viable strategy for enhancing specific gene targeting while mitigating off-target effects over extended durations.

Previous studies have demonstrated that the incorporation of VP substantially enhances the binding affinity of siRNAs for human Argonaute-2 (hAGO2), thereby improving their gene knockdown efficacy both in vitro and in vivo compared to that of their unmodified counterparts (Elkayam et al., 2016; Biscans et al., 2020a). Consistent with these findings, our study showed that siRNA modified with VP not only exhibited increased knockdown efficacy (Fig. 4F, 4G) but also induced greater cytotoxic effects in cancer cells (Fig. 4H, 4I). The natural phosphate group at the 5’ end of standard siRNAs is susceptible to rapid dephosphorylation, whereas VP provides a metabolically stable mimic that resists enzymatic breakdown (Parmar et al., 2016). The potency of asiRNA-VP was 4.2- and 7.7-fold greater than that of siRNA10 and asiRNA10-3, respectively (Fig. 4J). The enhanced potency was attributed to the addition of the VP modification. These findings highlight the importance of VP modification in enhancing the therapeutic efficacy of siRNAs, suggesting its potential utility in the development of more effective siRNA-based therapeutics.

Previous findings confirmed that reducing the number of 2’-F modifications while increasing the number of 2’-Ome modifications significantly enhances the stability of siRNAs both in vitro and in vivo (Foster et al., 2018). In this study, two of the asiRNAs were modified according to this strategy, and their knockdown efficacy was assessed in vitro (Fig. 1R, 1S). These modification patterns demonstrated substantial knockdown efficacy in MDA-MB-231 and MDA-MB-157 cells (Fig. 5A-5H). By reducing modifications at the 5’ end and decreasing the overall number of 2’-F modifications, this design strategy aimed to lessen the burden of excessive PS and fluoro modifications, thereby minimizing off-target effects such as toxicity associated with 2’-F modifications (Shen et al., 2018). Additionally, the increased incorporation of 2’-Ome modifications is known to enhance target binding affinity and nuclease resistance more effectively than 2’-F modifications (Foster et al., 2018).

Although extensive chemical modifications are critical for enhancing the overall activity of siRNAs, they can sometimes impair the activity of cleavage factor polyribonucleotide kinase subunit 1 (CLP1) (Parmar et al., 2016), which is known to phosphorylate exogenous duplex siRNAs in the cytosol (Monaghan et al., 2021). In our study, knockdown of MYC using Mod_asiRNA10-6 and Mod_asiRNA12-3 resulted in the overexpression of MYC mRNA, whereas Mod_asiRNA8-4 did not alter MYC mRNA levels (Fig. 5A). This overexpression of MYC mRNA, without a corresponding increase in protein levels, might be attributed to the interference of heavily modified guide strands with CLP1 kinase activity. This effect was particularly pronounced in the MDA-MB-231 cell line treated with Mod_asiRNA10-6 and Mod_asiRNA12-1. Although MYC mRNA was overexpressed, the mRNA and protein levels of RRM2 were significantly downregulated (Fig. 5B, 5F).

Additionally, treatment with asiRNA-VP led to dose-dependent overexpression of MYC mRNA in the MDA-MB-231 cell line (Supplementary Fig. 5A). Similar to Mod_asiRNA10-6 and Mod_asiRNA12-1, high doses of asiRNA-VP significantly downregulated the mRNA levels of the downstream targets of MYC, such as RRM2, RAD51, and PARP1 (Supplementary Fig. 5B-5D). These results confirm that siRNA10-derived guide strand modifications with 2’-Ome and 2’-F are sufficient to induce the overexpression of MYC mRNA in the MDA-MB-231 cell line. Differences in the knockdown efficacy of MYC downstream targets were observed between the siRNA8- and siRNA10-modified derivatives (Fig. 5B, 5D, 5F, 5G). For instance, the siRNA-10 derivative (Mod_asiRNA10-6) effectively downregulated RRM2, RDAD51 and PARP1 proteins in the MDA-MB-231 cell line (Fig. 5F), whereas the siRNA-8 derivatives (Mod_asiRNA8-4 and siRNA8-mf-PS) only partially downregulated the levels of these proteins despite efficient downregulation of the MYC protein (Fig. 5F).

For example, reducing the PS modifications at the 5’ end of the guide strand in Mod_asiRNA8-4 (Fig. 1R) circumvented the overexpression of MYC mRNA in the MDA-MB-231 cell line across all tested doses. This effect was not observed for Mod_asiRNA10-3 (Fig. 5A), indicating a dependency on sequence-specific responses. However, similar modifications did not induce the overexpression of MYC mRNA in other cell lines. Furthermore, this interference was specific to the MYC mRNA level, as evidenced by the significant knockdown (p<0.05) of MYC downstream targets such as RRM2 and PARP1 mRNA (Fig. 5B, 5D). Additionally, this interference did not affect the protein levels of MYC or its downstream targets (Fig. 5F, 5G). A notable distinction was observed between Mod_asiRNA8-4, siRNA8-mf, and siRNA8-mf-PS, the formers two did not induce MYC mRNA overexpression, whereas siRNA8-mf-PS showed unperturbed MYC mRNA levels (Supplementary Fig. 5G). These discrepancies could be attributed to the additional PS backbone modifications at the 5’ end of the guide strand on siRNA8-mf-PS. Therefore, we conclude that MYC mRNA overexpression might result from interference by heavily modified asiRNAs on CLP1 kinase activity (Parmar et al., 2016). The degree of overexpression was dependent on the cell line, siRNA sequence, dosage, and type of modification.

The use of DCA conjugation for in vivo delivery of siRNA was effective, as demonstrated by the sustained knockdown of MYC and its downstream target PARP1 (Fig. 6B-6D). Moreover, asiRNA-VP-DCA exhibited durable knockdown efficacy exceeding 46 days postdosing (Fig. 6D), suggesting the stability of this fully modified asiRNA formulation in serum and potentially within acidic endosomal compartments (Fig. 6D). It has been reported that acidic intracellular compartments act as long-term depots for siRNAs conjugated with GalNAc (Brown et al., 2020), a mechanism likely contributing to the prolonged activity of DCA-conjugated asiRNA-VP-DCA through continuous loading onto newly synthesized AGO2 protein complexes. However, inconsistencies in MYC mRNA and protein expression levels were noted in some mice, possibly due to individual differences. Importantly, no signs of toxicity were detected in either treatment group.

In this study, we developed novel asiRNAs, specifically asiRNA-VP and Mod_asiRNA10-6, along with design platforms (19+2/16+2 and 19+2/13+2). These were designed to target the MYC oncogene, incorporating validated modification patterns and with an in vivo delivery system for asiRNA-VP. AsiRNA-VP effectively knocked down MYC mRNA and protein levels both in vitro across various cell lines and in vivo via conjugation with DCA. This asiRNA was also proven to be safe in a mouse xenograft model. Notably, compared with other siRNAs with similar modifications, Mod_asiRNA10-6 exhibited superior knockdown efficacy for the MYC, RRM2, RAD51, and PARP1 proteins, such as Mod_asiRNA8-4, siRNA8-mf-PS, and Mod_asiRNA12-1. Additionally, cell viability was significantly reduced in MDA-MB-157 and MDA-MB-231 cell lines treated with Mod_asiRNA10-6. The design of Mod_asiRNA10-6 includes the removal of six nucleotides from the passenger strand, which constitutes approximately 71.4% of the seed region nucleotides, potentially minimizing seed-mediated off-target effects while maintaining knockdown efficacy. The successful downregulation of MYC mRNA and protein in a mouse xenograft model using asiRNA-VP-DCA underscores its potential for future therapeutic applications and further development.

Authors would like to thank Dr. Na Young Kim and Dr. Hong Seok Choi for their cooperation in the order, procurement and synthesis of asymmetric siRNA from abroad. Ms. Kang Young Im for procuring the reagents and materials used in this study.

This research was funded by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2022R1A6A1A03046247) and ABION BIO.

Authors declare no conflict of interests.

NM: Conceptualization, design, investigation, performing the experiments, data analysis, drafting and overall writing of the manuscript; MS: injected cells and drug to mice, and performed tumor tissue collection; HY: reviewed the initial and final version of manuscript; CC: helped in drafting of manuscripts and reviewed final version of the manuscript; JYC: Engaged in funding acquisition; SH: monitored the design of animal experiment, and reviewed the final version of manuscript; KS: reviewed the initial and final version of the manuscript; YKS: conceptualization, design, overall guidance, funding acquisition, guiding in drafting the initial and final version of manuscript.