The liver plays a central role in metabolizing alcohol, with chronic alcohol consumption increasing the risk of liver diseases, such as fatty liver, hepatitis, and cirrhosis (Contreras-Zentella et al., 2022). While the stomach initiates alcohol metabolism, most absorption occurs in the small intestine, and the liver metabolizes approximately 90% of the absorbed alcohol through oxidative and non-oxidative pathways (Hyun et al., 2021). In the oxidative pathway, alcohol dehydrogenase (ADH) converts ethanol to acetaldehyde, a toxic by-product responsible for symptoms such as nausea, vomiting, and headaches (Mackus et al., 2020). Acetaldehyde is further metabolized to acetate by aldehyde dehydrogenase (ALDH) and ultimately broken down into carbon dioxide and water for excretion (Yang et al., 2022). In individuals with impaired acetaldehyde metabolism, the accumulation of acetaldehyde can lead to liver damage and immune system disruption (Shiba et al., 2021).

Chronic alcohol consumption activates the microsomal ethanol oxidation system (MEOS), involving cytochrome P450 2E1 (CYP2E1). This shift leads to an increase in reactive oxygen species (ROS) production and depletes glutathione (GSH), a crucial antioxidant in hepatocytes (Chen et al., 2018). Excessive ROS generation causes cellular damage, triggers inflammation, and promotes apoptosis, contributing to alcoholic liver disease (Tan et al., 2020). Alcohol toxicity is further amplified by reactive oxygen and nitrogen species (ROS/RNS), which cause oxidative stress, damaging lipids, proteins, and DNA. Oxidative stress plays a key role in alcohol-induced diseases such as cardiomyopathy, liver damage, and neuronal disorders (Wu and Cederbaum, 2003; Haorah et al., 2008). The body’s defense against oxidative stress relies on antioxidant mechanisms governed by nuclear factor erythroid-2-related factor 2 (Nrf2), which regulates enzymes like superoxide dismutase (SOD) and catalase (CAT). Nrf2 activation also enhances the expression of heme oxygenase-1 (HO-1), protecting hepatocytes from oxidative damage (Bellezza et al., 2018).

Glutathione (GSH), a tripeptide consisting of glutamate, cysteine, and glycine, is a vital antioxidant that maintains cellular redox balance (Wu et al., 2004). Yeast extract, a rich source of GSH, has been shown to protect against liver disorders in animal studies (Park et al., 2014). However, its effects on alcohol-induced hangover symptoms and liver damage, especially following binge drinking, remain unclear. This study aims to evaluate the antioxidant properties of GSH and GSH-enriched yeast extract in mitigating hangover symptoms and alcohol-induced liver damage through both in vitro and in vivo.

Chemicals and reagents

Glutathione was obtained from Sigma-Aldrich Corporation (St. Louis, MO, USA). The enzyme analyses were carried out using commercially available kits in accordance with the manufacturer’s instructions (BioVision, Milpitas, CA, USA). Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were assessed with commercial kits from Asan Pharma, Hwasung, Korea. LR-grade chemicals and reagents were utilized in the investigations to ensure accuracy and consistency.

Preparations of yeast extract

Yeast extract (YE) with above 20% GSH (w/w) was prepared using a fermentative process with Candida utilis (Torula). In this investigation, the produced YE contains 21.25% of GSH. Thus, the concentrations used in the in vitro and in vivo investigations were determined according to the GSH levels present in the YE. YE was obtained from Samyang Corporation (Seongnam, Korea). Briefly, the yeast extract fermentation process begins with the cultivation of yeast under controlled conditions. Hot water extraction is then used to break down the yeast cells, releasing their nutrients. The mixture is filtered to remove unwanted solids and then sterilized to eliminate any microbes. Finally, the extract is dried into a powder for use in food, pharmaceuticals, and other industries. The glutathione assay method utilizes an adaptation of Ellman’s Reagent (DTNB), where 5,5’-dithiobis (2-nitrobenzoic acid) (DTNB) reacts with GSH to form the compound TNB (2-nitro-5-thiobenzoic acid), which is then quantified using HPLC analysis. The oxidized form of glutathione (GSSG) is reduced to GSH using DTT reagent, allowing for determining total glutathione content, including both oxidized and reduced forms. This method has been internally validated.

Ethics statement

The animal investigations were conducted strictly with the Principles of Laboratory Animal Care of the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC) of the Jeonbuk National University Hospital. The Institutional Animal Care and Use Committee (IACUC) of the Jeonbuk National University Hospital, Jeonju, Korea, approved the protocols utilized in this study. The approval number is CUH-IACUC-2021-7.

Animals and experimental design

Seven-week-old male Sprague Dawley (SD) rats were procured from Central Lab Animal Inc., Seoul, Korea. All the animals were cared for and acclimated to standard laboratory living conditions, with a 12 h L/D cycle and ad libitum food and water. Experimental animals were acclimatized for seven days prior to the investigation. Acclimatized rats were randomly divided into six groups, each with 10 animals. Control, rats received water; Ethanol, rats received 3 g/kg ethanol; GSH-L, Glutathione low group rats received 3 g/kg ethanol+glutathione 0.52 mg/kg (equal to the glutathione 5 mg/60 kg human dose); GSH-M, Glutathione medium group rats received 3 g/kg ethanol+glutathione 5.17 mg/kg (equal to the glutathione 50 mg/60 kg human dose); GSH-H, Glutathione high group rats received 3 g/kg ethanol+glutathione 25.83 mg/kg (equal to the glutathione 250 mg/60 kg human dose); YE, yeast extract group rats received 3 g/kg ethanol+24.31 mg/kg of yeast extract (equal to the YE dose of 235.29 mg/60 kg human). In the behavioral testing, the medium dose used in the experiments was selected based on the dose and glutathione content, with the YE dose determined by its glutathione content of 21.25%. The glutathione and yeast extract were dissolved in water and administered separately via oral gavage 30 min prior to ethanol administration. Whole blood samples were collected at specific time points (0, 0.5, 1, 3, 5, and 8 h) following ethanol administration. Tissue samples were collected from euthanized animals. The liver tissue was homogenized with a buffer solution having 250 mM sucrose, 50 mM Tris-HCl (pH 7.4), and 1 mM EDTA and stored with 4% paraformaldehyde (PFA) or at –80°C.

Behavioral analysis following ethanol administration

The Laboratory Animal Behaviour Observation, Registration, and Analysis System (LABORAS™, Metris B.V., Hoofddorp, Netherlands) was used to investigate rat locomotor movements, following the protocols previously outlined by Castagne et al. (2012). Briefly, the Control group rats received water; the Ethanol group rats received 3 g/kg ethanol; the GSH-M group (Glutathione medium dose) rats received 3 g/kg ethanol+5.17 mg/kg glutathione (equivalent to a 50 mg/60 kg human dose of glutathione); and the YE group (Yeast Extract) rats received 3 g/kg ethanol+24.31 mg/kg yeast extract (equivalent to a 235.29 mg/60 kg human dose of yeast extract). The glutathione and yeast extract were dissolved in water and administered separately via oral gavage 30 min prior to ethanol administration. The mechanical vibrations generated by the animals’ movements were electronically measured by positioning the animal enclosures on a sensor platform. Movements were monitored for 3.5 h, from 9:00 a.m. to 1:00 p.m. All recorded locomotion data were analyzed and calculated using LABORAS 2.6 software (Metris B.V.).

Measurement of ethanol and acetaldehyde levels

Blood alcohol levels were measured using an ethanol quantification assay kit, following the manufacturer’s guidelines (Megazyme International, Wicklow, Ireland). Briefly, 20X diluted serum was mixed with 25 μL of ALDH solution, 100 μL of 0.02% sodium azide, and 100 μL NAD⁺ reagent. The mixture was incubated at room temperature for 2 min, and absorbance (A1) was measured at 340 nm. Further, 10 μL ADH was added, and then the mixture was incubated at room temperature for 5 min, and absorbance (A2) was measured at 340 nm. The change in absorbance (A2-A1) was used to calculate the blood alcohol levels.

Measurement of alcohol dehydrogenase (ADH) activity

The ADH activity of the supernatant were measured using an Alcohol Dehydrogenase Assay kit (Abcam, Cambridge, UK). All the measurements were performed as suggested by the manufacturer. Briefly, the reaction mixture was prepared by combining 1 part of supernatant obtained from liver homogenates or whole blood with 10 parts of buffer containing ADH assay buffer, developer, and isopropanol. Subsequently, a standard curve was produced using concentrations of 0, 2, 4, 6, 8, and 10 nmol. The concentrations were prepared using a 1 mM NADH standard. Subsequently, 50 μL of the reaction mixture was transferred to the standard and sample wells in a 96-well plate and incubated at ambient temperature for three minutes. The absorbance was measured at 450 nm at regular intervals of 5 min over a duration of 120 min.

Determination of NAD⁺-dependent aldehyde dehydrogenase (ALDH) Activity

ALDH activity was determined using a colorimetric assay Kit (#K731-100, BioVision, Cambridge, UK). A 10X diluted sample was thoroughly mixed with reaction buffer having ALDH assay buffer, substrate mix, and acetaldehyde. Then, 50 μL of the resulting mixture was incubated at 22°C-24°C for 5 min, and the absorbance was measured at regular intervals of 5 min for up to 1 h at 450 nm. The resulting reaction time and sample volume was divided by the NADH released to determine ALDH activity (mU/mL). A standard curve was prepared using 0-10 nmol concentrations. The concentrations were prepared using a 1 mM NADH standard.

Measurement of antioxidant enzyme activities

All the enzyme activities were measured using commercially available test kits. Catalase activity (#K773, BioVision), SOD (#K335, BioVision), and activity of glutathione peroxidase (#K762, BioVision). All the protocols and analyses were performed as recommended by the manufacturers.

Determination of reactive oxygen species (ROS) using dihydroethidium (DHE)

ROS was determined using fixed tissues following a previously reported protocol (Lee et al., 2024). Briefly, fixed tissues were exposed to 10 mM DHE at ambient temperature for about 0.5 h. Then, exposed tissues were washed with PBS and observed under a confocal microscope. Relative fluorescence intensity was measured with ImageJ (National Institutes of Health, Bethesda, MD, USA).

Measurement of ROS and Malondialdehyde (MDA) in liver tissues

Homogenized liver tissues were mixed with 40 mM Tris-HCl buffer and centrifuged at 12,000× g for 10 min at 4°C to obtain supernatant. 50 μL of supernatant was mixed with 450 μL of 40 mM Tris-HCl buffer and 10 μL of 10 μM 2′,7′-dichlorofluorescein diacetate and incubated at 37°C for 30 min in the dark. The ROS levels were determined by fluorescence spectroscopy, where excitation and emission wavelengths were set at 482 nm and 535 nm, respectively. Further, MDA levels were assessed with OxiTec™ TBARS assay kit (#BO-TBR-200, BIOMAX Inc., Suwon, Korea) by following manufacturer guidelines.

Cell viability assay

Well-characterized and standardized human hepatoblastoma (HepG2) cells were obtained from Korea Cell Line Bank (Seoul, Korea). HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS), incubated in a standard humidified incubator. 1×10⁵ cells were seeded in each well in a 96-well plate and cultured for 24 h. These cells were treated with different concentrations of GSH and 600 mM of ethanol for 24 h to assess the influence of GSH against ethanol-induced cytotoxicity. The cell viability was measured using an 2,5-diphenyl-2H-tetrazolium bromide (MTT) assay kit (Sigma-Aldrich Corporation) following manufacturer guidelines.

RNA separation, reverse transcription-PCR, and quantitative real-time PCR

The RNA isolation and quantitative RT-PCR were performed as described earlier (Choi et al., 2023). Briefly, the total RNA from HepG2 cells and liver tissues was isolated using TRIzol (#15596026, Invitrogen, Waltham, MA, USA). Subsequently, oligo dT primers were used to perform reverse transcription with 2 µg of RNA. Then, the SYBR™ Green PCR Master Mix (#4309155, Applied Biosystems, Foster City, CA, USA) was utilized to determine the mRNA expression of the target genes. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an endogenous gene for analysis. Primer sequences used for qPCR are listed in Table 1. In this investigation, CYP2E1, Cat, Sod1, Gpx, ADH, ALDH, Nrf2, HO-1, and Keap1 were targeted to evaluate the influence of GSH against ethanol-induced toxicity.

Table 1 Primer sequences used for reverse transcription-polymerase chain reaction

Gene name	Direction	Sequence (5′-3′)
CYP2E1	Forward Reverse	GAGCACCATCAATCTCTGGACC CACGGTGATACCGTCCATTGTG	Human
	Forward Reverse	TGGCTACAAGGCTGTCAAGG AGGCTGGCCTTTGGTCTTTT	Rat
Cat	Forward Reverse	CGGCACATGAATGGCTATGGATC AAGCCTTCCTGCCTCTCCAACA	Human
	Forward Reverse	CCAGCGACCAGATGAAGCA TGGTCAGGACATCGGGTTTC	Rat
Sod1	Forward Reverse	CTCACTCTCAGGAGACCATTGC CCACAAGCCAAACGACTTCCAG	Human
	Forward Reverse	AAGCGGTGAACCAGTTGTG CCAGGTCTCCAACATGCC	Rat
Gpx	Forward Reverse	GTGCTCGGCTTCCCGTGCAAC CTCGAAGAGCATGAAGTTGGGC	Human
Gpx	Forward Reverse	TATAGAAGCCCTGCTGTCCA CAAGCCCAGATACCAGGAA	Rat
ADH	Forward Reverse	GAAACCCATCCAGGAGGTGCTA GACACTTGTGCCACATGCCTCA	Human
ALDH	Forward Reverse	CGGGAAAAGCAATCTGAAGAGGG GATGCGGCTATACAACACTGGC	Human
Nrf2	Forward Reverse	CACATCCAGTCAGAAACCAGTGG GGAATGTCTGCGCCAAAAGCTG	Human
	Forward Reverse	GAGCGGGAGAAATCACACAGAATG CAGGAGCTGCATGCACTCATCG	Rat
HO-1	Forward Reverse	CCAGGCAGAGAATGCTGAGTTC AAGACTGGGCTCTCCTTGTTGC	Human
	Forward Reverse	CGACAGCATGTCCCAGGATT TCGCTCTATCTCCTCTTCCAGG	Rat

Immunoblotting

Protein S-glutathionylation and protein content in tissue and cells were assayed by Western blot analysis as described (Han et al., 2016). The tissue homogenates and cell lysates were mixed with protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA, A32953 and A32957) to clear the lysates. Cleared lysates were separated using SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane. The membranes were blocked 5% skim milk and probed with primary antibodies against anti-GSH antibody (ViroGen, Watertown, MA, USA, #101-A-250, 1:500) under non-reducing condition, Grx1 (Abcam, ab45953, 1:1,000), GR (ABclonal, Woburn, MA, USA, A2164, 1:1,000), GST-π (MBL, Schaumburg, IL, USA, 312, 1:1,000), Bax (Santa Cruz Biotechnology, CA, USA, sc-7480, 1:1000), Bcl2 (Santa Cruz Biotechnology, sc-7382, 1:1000), cleaved caspase-3 (Cell Signaling, Danvers, MA, USA, #9661, 1:1000), and anti-β-actin antibody (Santa Cruz Biotechnology, sc-47778, 1:1000;). Next, membranes were washed and probed using secondary antibodies coupled with relevant species-specific horseradish peroxidase (HRP). The membranes were visualized with the help of an ECL detection system. Protein signal quantification was done with ImageJ (National Institutes of Health).

Immunofluorescence

Liver frozen sections and cells were performed as described previously (Seidel et al., 2021). Briefly, frozen liver sections and cell were fixed with ice-cold acetone at –20°C for 10 min and then blocked with 2.5% horse serum for 1 h. Then, sections were incubated against Grx1 (Abcam, ab187507, 1:500) and anti-GSH (ViroGen, #101-A-250, 1:1000). Next, the sections were incubated with a secondary antibody (Alexa Fluor 594-conjugated goat anti-mouse IgM, #A21044, 1:100 dilution, Thermo Fisher Scientific) at 37°C for 60 min. Eventually, fluorescence images were acquired on Zeiss microscopes (LSM900, Carl Zeiss, GmbH, Jena, Germany) utilizing the ZEN software provided with the microscope system.

Statistical analysis

The data presented in the charts and tables are expressed as the mean ± standard error of the mean (SEM). All statistical analyses were carried out with GraphPad Prism version 10.1.1 (GraphPad Software, San Diego, CA, USA). The data were examined using one-way analysis of variance (ANOVA) and subsequently underwent Tukey’s multiple comparisons test, where p<0.05 is considered significant. Data were expressed as mean ± SEM.

GSH and GSH-rich yeast extract induce improvements in alcohol-induced behavioral changes

This investigation used LABORAS to monitor the change in behavioural patterns in GSH and GSH-rich YE-treated alcoholic rats. The locomotor activities of the alcohol treatment group were significantly reduced relative to those of the control group. However, the locomotor activities of rats treated with 5.17 mg/kg of GSH and YE with 5.17 mg/kg of endogenously produced GSH were significantly enhanced (Fig. 1). These findings strongly indicate that GSH and GSH-rich YE effectively improved locomotor activities in alcoholic rats and suggest the positive influence of GSH in alleviating alcohol-induced behavioral changes.

Figure 1. GSH and GSH-rich yeast extract induce improvements in alcohol-induced behavioral changes. Rats received the specified treatments 30 min prior to ethanol administration. The analysis of locomotor activity was performed in four groups. Rats in the control and EtOH groups received water and 3 g/kg ethanol, respectively. GSH-M, Glutathione medium group rats received ethanol 3 g/kg+glutathione 5.17 mg/kg, equal to GSH 50 mg/60 kg human dose. YE group received 3 g/kg ethanol and 24.31 mg/kg of YE, equal to the GSH 235.29 mg/60 kg human dose. The mechanical vibrations generated by the animal’s movement are electronically measured by LABORAS™. The movements were monitored for 210 min. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; **p<0.01, compared to the ethanol group. GSH, glutathione; YE, GSH-rich yeast extract.

GSH and GSH-rich yeast extract promote ethanol metabolism in alcoholic rats

Multiple concentrations of GSH were administered to rats to evaluate its positive impact on alcohol toxicity. The evaluation of hepatocyte damage typically involves measuring serum levels of GOT and GPT (Giannini et al., 2005). However, no significant changes were observed in these tests across all groups, as shown in Supplementary Fig. 1A, 1B. On the other hand, a spike in ethanol and acetaldehyde levels was observed for 3 h following ethanol exposure, which was subsequently decreased in all groups over observation time. However, alcohol concentrations in GSH-treated groups decreased dose-dependently. Among these concentrations, GSH-H and YE showed a significant reduction in alcohol concentration and acetaldehyde levels (Fig. 2A, 2C). Furthermore, to measure the exposure that integrates concentration across time, the area under the concentration-time curve (AUC) was evaluated (Fig. 2B, 2D). The AUC of the group treated with alcohol treatment group was significantly higher than control group. The GSH-M, H and YE groups showed decreased of these alcohol and acetaldehyde AUC compared to the group that only received ethanol. These observations suggest that role of GSH in facilitating rapid alcohol metabolism in rats. Furthermore, the activity of ADH and ALDH in liver was assessed owing to their essential role in alcohol metabolism. Notably, the groups treated with GSH and YE showed elevated levels of these enzymes compared to the group that only received ethanol (Fig. 2E, 2F). Here, treatment of above 5.17 mg/kg of GSH (GSH-M) significantly enhanced the ADH and ALDH activity. Together, these observations indicated the beneficial effects of GSH in alcohol metabolism.

Figure 2. GSH and GSH-rich yeast extract promote ethanol metabolism in alcoholic rats. Rats received the specified treatments 30 min prior to ethanol administration. Rats in the control and EtOH groups received water and 3 g/kg ethanol, respectively. GSH-L group received 3 g/kg ethanol and glutathione 0.52 mg/kg, equal to the glutathione 5 mg/60 kg human dose. GSH-M group received ethanol 3 g/kg and glutathione 5.17 mg/kg, equal to GSH 50 mg/60 kg human dose. GSH-H group received ethanol 3 g/kg and glutathione 25.83 mg/kg, equal to GSH 250 mg/60 kg human dose. YE group received 3 g/kg ethanol and 24.31 mg/kg of YE, equal to the GSH 235.29 mg/60 kg human dose. The concentrations of alcohol and acetaldehyde were measured at predetermined intervals (0, 0.5, 1, 3, 5, and 8 h). (A, B) Alcohol concentrations and alcohol AUC (area under the curve), (C, D) acetaldehyde concentrations and acetaldehyde AUC, (E) ADH activity in liver, and (F) ALDH activity in liver rat exposed to binge drinking with or without GSH. Data represent mean ± SEM (n=10). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group. GSH, glutathione; GSH-L, GSH-low; GSH-M, GSH-medium; GSH-H, GSH-high; YE, GSH-rich yeast extract; ADH, Alcohol dehydrogenase; ALDH, aldehyde dehydrogenase.

GSH and GSH-rich yeast extract reduce oxidative stress in alcoholic rats

To further demonstrate that alcohol disrupts redox balance and contributes to cellular oxidative stress and damage, oxidative stress markers in ethanol-treated rats were examined. The groups treated with GSH and YE exhibited a notable reduction in ROS production compared to the control group exposed to ethanol alone (Fig. 3A-3C). In addition, levels of MDA, a marker of lipid peroxidation and free radical damage to hepatocytes, were significantly increased in the alcohol treatment group, highlighting the oxidative stress imposed by alcohol administration (Fig. 3D). Notably, the reduction of MDA levels was correlated with an increase in the dose of GSH, indicating the protection against liver oxidative stress induced by acute alcohol consumption. A significant effect was observed at GSH concentrations above the medium level (>5.17 mg/kg). Further, the expression levels of CYP2E1 mRNA were significantly higher in the alcohol treatment group (Fig. 3E, 3F). Conversely, the groups that received more than 5.17 mg/kg of GSH and YE showed a marked reduction in CYP2E1 mRNA expression levels, underscoring the antioxidant effect of GSH and GSH-rich YE in mitigating alcohol-induced oxidative stress.

Figure 3. GSH and GSH-rich yeast extract reduce oxidative stress in alcoholic rats. Rats received the specified treatments 30 min prior to ethanol administration. Rats in the control and EtOH groups received water and 3 g/kg ethanol, respectively. GSH-L group received 3 g/kg ethanol and glutathione 0.52 mg/kg, equal to the glutathione 5 mg/60 kg human dose. GSH-M group received ethanol 3 g/kg and glutathione 5.17 mg/kg, equal to GSH 50 mg/60 kg human dose. GSH-H group received ethanol 3 g/kg and glutathione 25.83 mg/kg, equal to GSH 250 mg/60 kg human dose. YE group received 3 g/kg ethanol and 24.31 mg/kg of YE, equal to the GSH 235.29 mg/60 kg human dose. (A) Representative dihydroethidium (DHE) and 2′,7′-dichlorofluorescin diacetate (H2DCFDA)-stained images depict ROS production. (B, C) Bar graphs showing quantification of ROS production using DHE and DCFDA stained images. (D) MDA levels. (E, F) CYP2E1 mRNA expression in liver tissues and respective quantification of mRNA levels. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group. GSH, glutathione; GSH-L, GSH-low; GSH-M, GSH-medium; GSH-H, GSH-high; YE, GSH-rich yeast extract.

GSH and GSH-rich yeast extract enhance antioxidant enzyme activity in alcoholic rats through Nrf2/Keap1 pathway activation

This study evaluated the activity of SOD and Catalase, as well as the mRNA expression of Sod1, Gpx, Nrf2, HO-1, and Keap1, to ascertain the influence of these factors on the activity of antioxidant enzymes in alcoholic rats. Liver tissues from the alcohol treatment group showed significantly reduced SOD, catalase, and Gpx, while administration of GSH restored these activities (Fig. 4A-4E). These findings suggested that administering GSH and GSH-rich YE supplements protects against hepatocyte injury. Additionally, GSH administration led to a dose-dependent upregulation of Nrf2 and its associated antioxidant HO-1 gene expression, as well as a downregulation of Keap1 expression, contrary to the alcohol treatment group (Fig. 4F-4H). These observations demonstrate that GSH and GSH-rich YE offer a defense against liver damage in ethanol-induced oxidative stress, primarily by enhancing the expression of antioxidant enzymes via the activation of the Nrf2/Keap1 signaling pathway.

Figure 4. GSH and GSH-rich yeast extract enhance antioxidant enzyme activity in alcoholic rats through Nrf2/Keap1 pathway activation. Rats received the specified treatments 30 min prior to ethanol administration. Rats in the control and EtOH groups received water and 3 g/kg ethanol, respectively. GSH-L group received 3 g/kg ethanol and glutathione 0.52 mg/kg, equal to glutathione 5 mg/60 kg human dose. GSH-M group received ethanol 3 g/kg and glutathione 5.17 mg/kg, equal to GSH 50 mg/60 kg human dose. GSH-H group received ethanol 3 g/kg and glutathione 25.83 mg/kg, equal to GSH 250 mg/60 kg human dose. YE group received 3 g/kg ethanol and 24.31 mg/kg of YE, equal to GSH 235.29 mg/60 kg human dose. (A, B) Activities of SOD and catalase in liver tissue were assessed. (C-H) Relative mRNA levels of Cat, Sod1, Gpx, Nrf2, HO-1, and Keap1 in the liver was measured. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group. SOD, Superoxide dismutase; GPx, Glutathione peroxidase; GSH, glutathione; GSH-L, GSH-low; GSH-M, GSH-medium; GSH-H, GSH-high; YE, GSH-rich yeast extract.

GSH and GSH-rich YE prevent apoptosis and inflammation in alcoholic rats

The pro-apoptotic protein Bax was upregulated in the rats treated with ethanol, while the anti-apoptotic protein Bcl-2 was downregulated. GSH dose-dependently downregulated Bax, whereas Bcl-2 was upregulated. Moreover, cleaved caspase-3 in the alcohol treatment group was enhanced, while the administration of GSH appeared to prevent cleavage (Fig. 5A, 5B). Moreover, real-time PCR showed an increase in pro-inflammatory cytokines, including IL-1b, Tnf, and IL-6 in the alcohol treatment group. However, the administration of GSH regulated these pro-inflammatory cytokines (Fig. 5C-5E). Specifically, GSH-M (5.17 mg/kg) and GSH-H (25.83 mg/kg) effectively prevented inflammation and apoptosis in liver tissues subjected to oxidative stress.

Figure 5. GSH and GSH-rich YE prevent apoptosis and inflammation in alcoholic rats. Rats received the specified treatments 30 min prior to ethanol administration. Rats in the control and EtOH groups received water and 3 g/kg ethanol, respectively. GSH-L group received 3 g/kg ethanol and glutathione 0.52 mg/kg, equal to the glutathione 5 mg/60 kg human dose. GSH-M group received ethanol 3 g/kg and glutathione 5.17 mg/kg, equal to GSH 50 mg/60 kg human dose. GSH-H group received ethanol 3 g/kg and glutathione 25.83 mg/kg, equal to GSH 250 mg/60 kg human dose. YE group received 3 g/kg ethanol and 24.31 mg/kg of YE, equal to the GSH 235.29 mg/60 kg human dose. (A, B) Immunoblotting analysis of proapoptotic Bax, Bcl-2, and cleavage of caspase 3 and respective qualifications are shown in the bar graphs. (C-E) mRNA expression of inflammatory mediators (IL-1b, Tnf, and IL-6) was measured. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group). Il1b, interleukin 1-β; Tnf, Tumor necrosis factor; Il6, interleukin 6; GSH, glutathione; GSH-L, GSH-low; GSH-M, GSH-medium; GSH-H, GSH-high; YE, GSH-rich yeast extract.

GSH enhances HepG2 cell viability and regulates factors associated with alcohol metabolism and oxidative stress

The MTT assay indicated that GSH has a limited influence on cell viability (Fig. 6A). This observation suggests that GSH has no cytotoxic effect on HepG2 cells at concentrations below 1 mM. Interestingly, Ethanol treatment significantly reduced the viability of HepG2 cells, while GSH dose-dependently showed a positive influence on cell viability. Specifically, GSH at 0.5 mM and above significantly improved the cell viability (Fig. 6B). These data clearly indicate that GSH effectively protects cells against ethanol-induced cytotoxicity. Additionally, the mRNA expression of ADH and ALDH in HepG2 cells was significantly reduced in ethanol treatment, whereas GSH significantly increased ADH and ALDH mRNA expression (Fig. 6C, 6D). On the contrary, the expression of CYP2E1 was substantially elevated with ethanol treatment, whereas GSH significantly reduced CYP2E1 expression (Fig. 6E). Similarly, ethanol treatment stimulated MDA accumulation, while GSH administration significantly inhibited MDA (Fig. 6F). Furthermore, the mRNA expression of antioxidant enzymes, such as Cat, Sod1, and Gpx, was greatly reduced by ethanol treatment. However, the GSH treatment restored these decreased gene expressions (Fig. 6G-6I). Similarly, the expression of Nrf2 and HO-1 was suppressed by ethanol treatment, while Keap1 was increased. Notably, the mRNA expressions of these genes were positively regulated by GSH (Fig. 6J-6L).

Figure 6. GSH enhances HepG2 cell viability and regulates factors associated with alcohol metabolism and oxidative stress. HepG2 cells were exposed to 600 mM ethanol, with or without GSH treatment, for 24 h. (A, B) Cell viability following GSH treatment was assessed. (C-E) The relative mRNA levels of ADH, ALDH, and CYP2E1 were quantified. (F) MDA levels were determined. (G-L) The relative mRNA expression of Cat, Sod1, Gpx, Nrf2, HO-1, and Keap1 was also measured. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group. GSH, glutathione; Sod1, Superoxide dismutase 1; Gpx, Glutathione peroxidase; CYP2E1, cytochrome P450 family 2 subfamily E member 1; HO, heme oxygenase; Nrf2, Nuclear factor erythroid 2-related factor 2; Keap1, Kelch-like ECH-associated protein 1.

GSH regulates protein S-glutathionylation and Grx1/GST-π regulatory system in vivo and in vitro

The impact of ethanol metabolism on protein S-glutathionylation was investigated in HepG2 cells and liver tissues. Liver tissue was collected and subjected to biochemical analysis to examine protein S-glutathionylation and its regulatory system (Fig. 7A). In this study, the ethanol-treated group exhibited a significant increase in protein S-glutathionylation in liver tissues. However, treatment with GSH and GSH-rich YE significantly reduced the levels of protein S-glutathionylation (Fig. 7B). The immunofluorescence analysis of liver cross-sections also confirmed that the ethanol administration stimulated protein S-glutathionylation, while GSH significantly regulated protein S-glutathionylation (Fig. 7C, 7D). Additionally, the Grx1 levels were significantly improved with GSH treatment (Fig. 7C, 7D). Moreover, the protein levels of Grx1 and GR, which are key enzymes that regulate S-glutathionylation, were substantially reduced in the alcohol treatment group compared to the control group. However, GSH administration restored the levels of these proteins and positively regulated the S-glutathionylation. On the contrary, GST-π levels were enhanced in the alcohol treatment group, whereas GSH significantly reduced GST-π levels (Fig. 7E, 7F). Similarly, the in vitro analysis of HepG2 cells revealed comparable results to those observed in vivo (Fig. 8). Collectively, these results indicate that GSH and GSH-rich YE effectively regulate liver protein S-glutathionylation induced by binge drinking. This regulation is likely achieved through the modulation of enzymes implicated in the glutathionylation/deglutathionylation process.

Figure 7. GSH regulates protein S-Glutathionylation and Grx1/GST-π Regulatory System in vivo. (A) Schematic diagram showing modulation of enzymes implicated in the glutathionylation/deglutathionylation process. (B) Liver lysate was incubated without or with GSSG/GSH on ice for 30 min and afterward free Cysteine residues alkylated with N-Ethylmaleimide (NEM). After removing unbound GSSG/GSH/NEM, the samples were subjected to 10% NuPAGE Bis-Tris SDS-PAGE under non-reducing conditions and immunoblot was performed with GSH antibody. Protein S-glutathionylation (PrS-SG) levels in liver tissue homogenate. Proteins were isolated and immunoblotted under non-reducing conditions. PrS-SG levels were detected with the anti-GSH antibody. (C) Immunofluorescence analysis of PrS-SG and Grx1 expression in the liver. Fresh and frozen cross-sections of the liver without evident lesions were immunostained for PrS-SG and Grx1, and (D) they were quantified. (E) Immunoblotting of Grx1, GST-π, and GR and (F) the expressions were quantified. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01, compared to the ethanol group. GSH, glutathione; GSH-L, GSH-low; GSH-M, GSH-medium; GSH-H, GSH-high; YE, GSH-rich yeast extract; Grx, Glutaredoxin; GST-π, Glutathione-s-transferase-pi, DAPI, 4′,6-diamidino-2-phenylindole.

Figure 8. GSH regulates protein S-Glutathionylation and Grx1/GST-π Regulatory System in vitro. HepG2 cells were treated with 600 mM in the presence of 0, 0.25, 0.5, and 1 mM GSH for 24 h. (A) PrS-SG levels were detected with the anti-GSH antibody. (B) Representative immunofluorescence images showing the expression of PrS-SG and Grx1 in HepG2 cells. (C) The fluorescence intensity (red) was quantified for respective analyses. (D) Immunoblotting was performed for Grx1, GST-π, GR, and β-actin. (E) The expression levels were quantified. Data represent mean ± SEM (n=5). ^#p<0.001, compared to the control group; *p<0.05; **p<0.01; ***p<0.001, compared to the ethanol group. GSH, glutathione; Grx, Glutaredoxin; GST-π, Glutathione-s-transferase-pi.

The study demonstrates that GSH and GSH-rich YE effectively controlled hangover symptoms in rats exposed to binge drinking by enhancing alcohol metabolism. The GSH administration lowered ROS production and lipid peroxidation, indicating reduced oxidative stress. Additionally, GSH and GSH-rich YE restored the activity of antioxidant enzymes and upregulated the Nrf2 signaling pathway, highlighting their protective role against ethanol-induced liver damage. These findings underscore the potential of GSH and YE in mitigating alcohol-induced liver toxicity and oxidative stress (Fig. 9).

Figure 9. Proposed mechanisms by which glutathione protects against acute binge alcohol-induced hangover symptoms.

In this investigation, an alcohol hangover was induced in rats by administering a single acute dose of alcohol. GSH and GSH-rich YE effectively inhibited hangover patterns and improved motor coordination (Fig. 1). The findings of this study, combined with previous investigations (Choi et al., 2023; Kim et al., 2023), suggest that these compounds may alleviate the negative effects of alcohol on behavior function, emphasizing the importance of alcohol metabolism in liver in managing alcohol-induced effects. In this binge drinking rat model, ADH and ALDH activity were markedly decreased, whereas they were significantly recovered by GSH and GSH-rich YE (Fig. 2E, 2F). These observations demonstrate that GSH is an effective compound that regulates alcohol metabolism and associated antioxidant actions. Further, YE with high GSH concentrations exhibits comparable effects. Interestingly, a similar effect was observed in YE obtained from S.cerevisiae (Data not shown). This suggests that treatments used in the investigation might mitigate alcohol-associated toxicity symptoms, including hangovers. Excessive alcohol metabolism in the liver produces ROS that can cross the blood-brain barrier, contributing to behavioral impairments associated with hangovers (Choi et al., 2023; Kim et al., 2023). Reducing ROS levels could potentially ameliorate both hepatic and neurological symptoms of alcohol toxicity.

Furthermore, the study results demonstrate that GSH treatments significantly reduce ROS accumulation in ethanol-treated HepG2 cells and in vivo models, highlighting their potential in mitigating alcohol-induced oxidative stress. Ethanol treatment induces CYP2E1 overexpression, leading to increased oxidative stress (Ma et al., 2023). Consistent with these findings, a significant reduction in ROS levels and MDA accumulation was observed in rats exposed to binge drinking. However, GSH administration upregulated antioxidant enzyme expressions, which facilitated the regulation of ROS levels and the accumulation of MDA (Fig. 4, 6). It is widely recognized that the activation of Nrf2, a transcription factor with antioxidant and anti-inflammatory properties, regulates elevated oxidative stress (Yu et al., 2010). Therefore, it is reasonable to anticipate that natural antioxidants may contribute to preventing alcoholic liver diseases by regulating the Nrf2 pathway. Here, GSH and GSH-rich YE activate the Nrf2 pathway and induce transcription of antioxidant enzymes in HepG2 cells, restoring reduced antioxidants including HO-1 (Fig. 6). This observation suggests that GSH exerts antioxidant activity by activating the Nrf2 signaling pathway to inhibit ROS oxidative damage and prevent alcohol-induced oxidative stress.

Additionally, the findings of the study indicate that the efficacy of GSH is contingent upon the concentration at which it is administered, with rats exhibiting significant effects at a dose of 5.17 mg/kg and higher. The significance of this specific dose was further demonstrated by its notable regulation of key biomarkers associated with alcohol metabolism and oxidative stress. When this specific concentration is converted to human intake standards, an effective concentration corresponds to the consumption of 50 mg of GSH per 60 kg of body weight. Further, alcohol-induced oxidative stress in the liver was also regulated by protein modifications such as protein S-glutathionylation. GSH, in its reduced (GSH) and oxidized (GSSG) forms, plays a critical role in oxidative stress regulation and detoxification (McBean, 2017). The study findings indicate that ethanol stimulates protein S-glutathionylation in the liver and HepG2 cells (Fig. 7A, 7B, 8). GSH administration markedly decreased protein S-glutathionylation (Fig. 7C-7E). Protein levels of key regulatory enzymes, such as Grx1 and GST-π, were altered by ethanol treatment and antioxidant intervention (Fig. 7E, 7F). Our data suggest that glutathione and yeast extract containing glutathione effectively control liver protein S-glutathionylation induced by binge drinking, possibly through regulating glutathionylation/deglutathionylation enzyme levels. This study offers a potential therapeutic approach for mitigating alcohol-induced hepatic oxidative stress and alcohol metabolite accumulation, while addressing alcohol-associated hangover symptoms. Although glutathione has limited oral bioavailability due to gastrointestinal degradation, studies show that orally administered GSH can still elevate tissue glutathione levels and improve antioxidant defence. For example, it was demonstrated that GSH raised glutathione levels in the liver and plasma (Favilli et al., 1997, Richie et al., 2015). Additionally, other research supports its capacity to enhance antioxidant enzyme activity and mitigate oxidative stress in tissues (Yamada et al., 2018). These findings suggest that even with some degradation, GSH or its metabolites can still exert protective effects, as observed in our study.

In summary, glutathione and yeast extract containing glutathione alleviate hangovers by reducing alcohol and acetaldehyde concentrations in the blood, thereby highlighting their role in regulating oxidative stress. Given that glutathione is an efficacious compound for alcohol metabolism and antioxidant actions, and that yeast extract containing glutathione shows equivalent effects, this study suggests that glutathione, a natural ingredient from yeast extract, can alleviate hangover symptoms through its antioxidant activity and ability to enhance alcohol metabolism. Therefore, glutathione and yeast extract containing glutathione are proposed as alternative natural functional food products to prevent the negative effects of binge drinking.

This work was supported by Samyang Corp., Seongnam-si, Republic of Korea.

The authors declare the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: Yeast extract (YE) was obtained from Samyang Corporation. These contributions could be perceived as potential conflicts of interest. However, the authors affirm that the data interpretation and the conclusions drawn in this study are based solely on the scientific evidence presented.