Inflammation, a foundational reaction prompted by infection or injury, assumes a paramount role in the etiology of persistent maladies such as asthma, rheumatoid arthritis, and atherosclerosis (Chen et al., 2018). Recently, neuroinflammation has emerged in a central position in the genesis of diverse neurodegenerative diseases (Allison and Ditor, 2014; Kwon and Koh, 2020). Microglia, the principal immunocytes within the central nervous system, activates as a response to brain injury, inflammation, and infection, producing different pro-inflammatory and neurotoxic molecules such as cytokines and nitric oxide (NO) (Streit et al., 2004; Perry et al., 2010; Colonna and Butovsky, 2017). It is crucial to underscore the significance of inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2) as pivotal enzymes in the inflammatory processes (Choi et al., 2008). Furthermore, stimulated microglia unleash pro-inflammatory cytokines that amplify neuronal damage by propelling neuroinflammatory pathways (Choi and Park, 2012). Hence, the deliberate control of inflammatory reactions via the manipulation of microglia presents a promising avenue for therapy (Liu and Hong, 2003).

The prominent transcription factor NF-κB plays a crucial role in orchestrating the expression of TNF-α, IL-6, COX-2, and matrix metalloproteinases (MMP) across various inflammatory conditions and within macrophages (Firestein, 2003; Tas et al., 2005; Kim et al., 2021a). Concomitantly, mitogen-activated protein kinases (MAPKs), encompassing c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38, wield dominion over cellular retorts to an array of stimuli, notably pro-inflammatory cytokines, thus intricately governing cellular activities and the inflammatory milieu (Han et al., 2012; Kim et al., 2021b). Many studies attest to the potential of suppressing inflammatory responses through the attenuation of the NF-κB/p65 subunit and MAPKs signaling cascades (Ha et al., 2012).

Yakuchinone B an element residing within the seeds of Alpinia oxyphylla, pertains to the category of natural chalcones characterized by a conjugated 1, 4-enone moiety in conjunction with a phenyl ring, bestowing a diverse spectrum of biological functionalities including anti-inflammatory attributes (Yamazaki et al., 2000). Previous studies have shown that JCII-8, an offshoot derivative of Yakuchinone B, has an anti-inflammatory effects on BV2 microglia cells and confers neuroprotective qualities against excitotoxicity via modulation of the JAK2/STAT3 and MAPKs pathways in a model of ischemic MCAO (middle cerebral artery occlusion) (Jang et al., 2009). Subsequent to the synthesis of JCII-8, a succession of JCII compounds were created through progressive alterations (Table 1). In the present study, a triad of archetypal chalcone compounds, namely JCII-8,10,11, were judiciously selected from an array of synthetic derivatives, paving the way for the innovation and formulation of groundbreaking compounds characterized by augmented anti-inflammatory efficacy. To discern the mechanisms underpinning the inhibition of inflammatory responses, investigations were conducted in both in vitro and in vivo models of inflammation.

Table 1 Chemical structures of JCII compounds and HOMO, LUMO levels. HOMO, highest occupied molecular orbital; LUMO, lowest unoccupied molecular orbital

Group	Compound	R1	R2	R3	R4	R5	R6	HOMO level (eV)	LUMO level (eV)	HOMO-LUMO gap (eV)
A	JCII-8	OH	OCH3	H	H	H	H	–5.78	–1.68	4.1
	JCII-10	OH	OCH3	H	F	F	F	–5.99	–2.05	3.94
	JCII-11	OH	OCH3	H	F	OCH3	H	–5.75	–1.61	4.14
B	JCII-12	OCH3	OH	H	H	H	H	–5.96	–2.7	3.26
	JCII-14	OCH3	OH	H	F	F	F	–6.04	–3.03	3.01
	JCII-15	OCH3	OH	H	F	OCH3	H	–5.92	–2.75	3.17
C	JCII-16	H	OCH3	OH	H	H	H	–6.02	–2.77	3.25
	JCII-18	H	OCH3	OH	F	F	F	–6.11	–2.98	3.13
	JCII-19	H	OCH3	OH	F	OCH3	H	–5.99	–2.71	3.28

Reagents

The synthesis of benzylideneacetophenone derivatives was previously divulged utilizing established methodologies (Oh et al., 2006). The protection of 4-hydroxy-3-methoxy cinnamaldehyde was achieved using tert butyldimethylsilyl trifluoromethanesulfonate, in the presence of either 2,6-lutidine or 2 (trimethylsilyl) ethoxymethyl chloride (SEM–Cl)/N, N-di-isopropylethylamine, which yielded aldehydes with 95% and 97% efficiency, respectively. The benzylideneacetophenone compounds (JCII-8,10,11) underwent a thorough characterization process employing infrared and nuclear magnetic resonance (NMR) spectroscopies, complemented by high-resolution mass spectrometry (Jung et al., 2008). Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against TNF-α, IL-6, and COX-2 were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies for β-actin, iNOS, phosphorylated- and total-forms of p38, JNK/SAPK, ERK1/2, IKKα, IKKβ, IκBα, and NF-κB/p65 were bought from Cell Signaling Technology (Danvers, MA, USA). HRP-linked anti-rabbit IgG and anti-mouse IgG secondary antibodies were obtained from Bio-Rad (Hercules, CA, USA). Bionics (Seoul, Korea) provided the primers (TNF-α, COX-2, IL-1β, iNOS, and GAPDH), while all remaining reagents were sourced from Sigma-Aldrich.

Molecular modeling

The lower energy conformational preferences of each JCII-8,10,11 compounds were explored utilizing the semi-empirical AM1 method (Dewar et al., 1985). Subsequent to the identification of energetically favorable conformers, those possessing diminished energy levels underwent geometric optimization and energy calculations, leveraging the density functional theory (DFT) model at the B3LYP 6-31G** level (Kohn et al., 1996). Additionally, the HOMO (highest occupied molecular orbital) and LUMO (lowest unoccupied molecular orbital) values of the chosen conformers were ascertained, as illustrated in Table 1. All computational undertakings and graphical renditions were executed employing the SPARTAN 06 software suite (Wavefunction, Irvine, CA, USA) tailored for the Windows platform.

Animals

Male ICR mice (28-30 g, 8 weeks old) were purchased from Samtaco Animal Co. (Osan, Korea). Prior to experimentation, a one-week acclimatization period was observed for the mice. They were domiciled within a controlled climatic environment under a 12/12-h light/dark cycle (08:00-20:00 h light, 20:00-08:00 h dark), characterized by a temperature of 23 ± 2°C and a humidity level of 50 ± 10%. The mice were provided ad libitum access to a standard laboratory diet and water throughout the study. All experimental procedures were conducted in rigorous adherence to established guidelines for animal research, and the study protocol garnered endorsement (MRI 10-4) from the Institutional Animal Care and Use Committee at the School of Medicine, Ewha Womans University.

Cell culture

The BV2 cell line, derived from murine microglia, underwent immortalization by way of v-raf/v-myc recombinant retrovirus infection, leading to characteristics resembling reactive microglial cells. Cultivation of BV2 cells took place in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), along with streptomycin (10 μg/mL) and penicillin (10 U/mL), in an environment set at 37°C with 5% CO₂. Once the cells reached a 90% confluence, the culture medium was replaced with a serum-free alternative, followed by an additional 24-h incubation period. Subsequently, the JCII-8,10,11 compounds were introduced to the serum-free medium at designated concentrations. Subsequent to this, the cells were exposed to LPS stimulation after a one-h interval subsequent to JCII-8,10,11 introduction. Following six hours of agent treatment, RT-PCR and western blot analyses were executed. Moreover, MTT and NO assays were executed post a 24-h agent exposure interval.

Measurement of nitric oxide

BV2 cells were seeded at 2.5×10⁵ cells per well in a 24-well plate. Pre-treatment with varying concentrations of JCII-8,10,11 ensued for one hour, followed by exposure to LPS (100 ng/mL) over a 24-h period. Subsequently, supernatants derived from the cultured microglia were harvested. The quantification of accumulated nitric oxide (NO) levels was conducted utilizing the Griess reagent sourced from Promega (Madison, WI, USA), following the stipulated protocol. Absorbance readings were recorded at 550 nm employing an automated microplate reader, specifically the SpectraMax ABS plus ELISA microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Total RNA isolation and RT-PCR analysis

In a 6-well plate, BV2 cells (4.5×10⁵ cells per well) underwent pretreatment with varying concentrations of JCII-8,10,11 for one hour, followed by LPS stimulation (100 ng/mL) for six hours. The TRIzol reagent (Ambion, Thermo Fisher Scientific, Waltham, MA, USA) was utilized for total RNA extraction. To initiate cDNA synthesis, 1 μg of total RNA was mixed with RNase inhibitor, random primers, 2.5 mM deoxyribonucleoside triphosphates (dNTPs), and 5×RT buffer, and then incubated for one hour at 42°C. The resultant cDNA was subsequently employed in a reverse transcription-polymerase chain reaction (RT-PCR) using specific primers designed for iNOS, COX-2, TNF-α, IL-1β, and GAPDH (Table 2). The resulting PCR products were separated by electrophoresis on a 1% agarose gel and visualized after staining with GelRed (iNtRON Biotechnology, Seongnam, Korea). The intensity of the bands was assessed under ultraviolet (UV) light, and their relative levels were carefully normalized to the reference GAPDH band.

Table 2 Primer sequences for RT-PCR

Species	Gene	Forward Primer (5’→3’)	Reverse Primer (5’→3’)	Size
Mouse	iNOS	GTGTTCCACCAGGAGATGTTG	CTCCTGCCCACTGAGTTCGTC	576 bp
	COX-2	AAGACTTGCCAGGCTGAACT	CTTCTGCAGTCCAGGTTCAA	150 bp
	TNF-α	TGTCTCAGCCTCTTCTCATT	GTATGAGATAGCAAATCGGC	360 bp
	IL-1β	AGCAACGACAAAATACCTGT	CAGTCCAGCCCATACTTTAG	426 bp
	GAPDH	AACTTTGGCATTGTGGAAGG	ACACATTGGGGGTAGGAACA	223 bp

Western blotting

Cells and brain tissues were lysed using radio-immunoprecipitation assay (RIPA, Elpis Biotech Inc., Daejeon, Korea). The protein content was quantified using the bicinchoninic acid (BCA) protein assay reagents from Thermo Fisher Scientific. After separation by SDS PAGE, the samples were transferred onto a nitrocellulose membrane and subsequently blocked with 5% skim milk dissolved in Tris-buffered saline containing Tween-20 (TBST) for a duration of 1 h. The membranes were incubated with primary antibody overnight at 4°C. Following trilateral washing steps with TBST, the membranes underwent a secondary probing with horseradish peroxidase (HRP)-conjugated antibodies for 1 h. The protein bands were visualized using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific).

Experiment of animal model

Male ICR mice (8 weeks old) underwent intraperitoneal administration of JCII-8,10,11 at a dose of 30 mg/kg or an equivalent saline (control), administered once daily across a span of four consecutive days. On the fourth day, an intraperitoneal injection of LPS (5 mg/kg) was conducted, one hour after the final JCII-8,10,11 administration (Banks et al., 2015). Following an additional temporal lapse of three days, the mice were humanely sacrificed, thus facilitating subsequent analysis.

Statistical analysis

All data are showed in the form of mean values accompanied by their respective standard error of the means (SEMs). The execution of statistical comparisons between distinct groupings was achieved through t-tests and one-way ANOVA, which were further supplemented by Tukey’s post hoc examination. Statistical significance was attributed to instances wherein p-values were less than the conventional threshold of 0.05.

The inhibitory effects of JCII-8,10,11 on nitric oxide (NO) production and pro-inflammatory mediators within LPS-treated BV2 cells were demonstrated

The present inquiry sought to elucidate the anti-inflammatory properties inherent in JCII-8,10,11, by assessing their impact on nitric oxide (NO) generation and inflammatory mediator response. Experimental application of JCII-8,10,11 compounds at concentrations of 5, 10, and 20 μM were not detrimental to cellular viability after 24 h (Data not shown). BV2 cells were subjected to LPS (100 ng/mL) in the presence or absence of JCII-8,10,11. As shown in Fig. 1, increased NO production within LPS-activated BV2 cells exhibited an inhibitory effect on JCII-8,10,11 in a dose-dependent manner. All JCII compounds showed NO inhibition tendency, but among them, JCII 11 showed the most notable effect. To ascertain the impact of JCII-8,10,11 on the transcriptional control of inflammatory mediators, we validated their mRNA expression levels through RT-PCR analysis. As depicted in Fig. 2, the treatment of LPS notably elevated the mRNA expression levels of iNOS, COX-2, TNF-α, and IL-1β cytokines.

Figure 1. Effects of JCII-8,10,11 on reducing NO production in BV2 cells stimulated with LPS. BV2 cells were pretreated with JCII-8,10,11 for 1 h before stimulation with LPS at a concentration of 100 ng/mL for 24 h. Subsequently, 50 μL of the harvested medium was used to quantify NO production using Griess reagent. All data are expressed as the mean ± SEM of three separate experiments. ^###p<0.001 vs. untreated group (none); ***p<0.001 vs. LPS-only treated group.

Figure 2. Effects of JCII-8 (A), 10 (B), 11 (C) on mRNA expression of inflammatory mediators BV2 cells stimulated with LPS. The levels of iNOS, TNF-α, COX-2, and IL-1β mRNA were quantified through RT-PCR. The indicated concentrations of JCII-8 (A), JCII-10 (B), and JCII-11 (C) were applied to BV2 cells 1 h before stimulation with 6 h of LPS (100 ng/mL). All data are expressed as the mean ± SEM of three separate experiments. ^###p<0.001 vs. untreated group (none); *p<0.05, **p<0.01, and ***p<0.001 vs. LPS-only treated group.

In Fig. 2A, JCII-8 demonstrated a substantial inhibition of LPS-induced mRNA expression of iNOS, COX-2, and IL-1β. Fig. 2B illustrates a significant reduction in LPS-induced mRNA expression of iNOS and COX-2 due to JCII-10. Furthermore, Fig. 2C depicts JCII-11 causing a notable inhibition in LPS-induced mRNA expression of iNOS, TNF- α, and COX-2. Hence, the findings affirm that JCII-8,10,11 exert an inhibitory influence on both LPS-induced NO production and mRNA expression of inflammation-related mediators in BV2 cells.

JCII-8,10,11 exhibited a reduction in the protein expression levels of inflammatory mediators in BV2 cells stimulated with LPS

In order to investigate deeper into the anti-inflammatory attributes of JCII-8,10,11, Western blot analysis was employed to assess the protein levels of crucial inflammatory mediators including TNF-α, IL-6, iNOS, and COX-2. BV2 cells were subjected to LPS stimulation (100 ng/mL) for six hours, either without JCII-8,10,11 or following a one-hour pretreatment. Notably, the stimulation with LPS led to a significant elevation in the protein expression levels of TNF-α, IL-6, iNOS, and COX-2. Each of the three compounds, JCII-8 (Fig. 3A), JCII-10 (Fig. 3B), and JCII-11 (Fig. 3C), exhibited a dose-dependent inhibition of protein levels for every inflammatory mediator. These results robustly indicate that JCII 8,10,11 exerts an inhibitory influence on the protein expression of inflammatory mediators in BV2 cells when stimulated with LPS.

Figure 3. Effects of JCII-8,10,11 on protein expression of iNOS, TNF-α, COX-2, and IL-6 in BV2 cells stimulated with LPS. BV2 cells underwent a pretreatment step for 1 h with the indicated concentration of JCII 8 (A), 10 (B), 11 (C) and then exposed to LPS (100 ng/mL) for 6 h. The protein expression of iNOS, TNF-α, COX-2, and IL-6 was quantified by western blot analysis. All data are expressed as the mean ± SEM of three separate experiments. ^###p<0.001, and ^#p<0.05 vs. untreated group (none); ***p<0.001, and **p<0.01 vs. LPS-only treated group.

The anti-inflammatory effects of JCII-8,10,11 on LPS-stimulated BV2 cells are regulated through the MAPK signaling pathway

The MAPK pathways play a pivotal role in initiating upstream signaling events in the inflammatory processes. To elucidate the underlying molecular mechanisms responsible for the alleviation of previously mentioned inflammatory mediators induced by JCII-8,10,11, the activation status of this pathway was closely investigated by Western blot analysis. This includes the utilization of antibodies targeting both phosphorylated and full forms of extracellular signal-regulated kinase (ERK)1/2, c-Jun N-terminal kinase (JNK), and p38 (Fig. 4). In particular, JCII-8,10,11 showed significantly reduced phosphorylation levels of p38, JNK, and ERK MAPK within LPS-stimulated BV2 cells.

Figure 4. Effects of JCII-8,10,11 on the expression of protein levels involved in MAPKs signaling in BV2 cells stimulated with LPS. BV2 cells underwent a pretreatment step for 1 h with the indicated concentration of JCII 8 (A), 10 (B), 11 (C) and then exposed to LPS (100 ng/mL) for 6 h. Quantification of MAPK signaling protein expression was performed by Western blot analysis. All data are expressed as the mean ± SEM of three separate experiments. ^###p<0.001, ^##p<0.01, and ^#p<0.05 vs. untreated group (none); ***p<0.001, **p<0.01, and *p<0.05 vs. LPS-only treated group.

The anti-inflammatory effects of JCII-8,10,11 occur by regulating the nuclear translocation of NF-κB in LPS-stimulated BV2 cells

Figure 5 shows the effects of JCII-8,10,11 on the increased nuclear translocation of nuclear factor kappa B (NF-κB) in BV2 cells stimulated by LPS. Western blot analysis was performed using phosphorylated- and total-forms of NF-κB, inhibitory κB (IκB), and IκB kinase (IKK) antibodies. The protein levels of pIKKαβ and pNF-κB, which were significantly elevated by LPS stimulation, were alleviated by JCII-8,10,11 pretreatment.

Figure 5. Effects of JCII-8,10,11 on expression of proteins related to NF-κB signaling in LPS-stimulated BV2 cells. BV2 cells underwent a pretreatment step for 1 h with the indicated concentration of JCII 8 (A), 10 (B), 11 (C) and then exposed to LPS (100 ng/mL) for 6 h. The quantification of NF-κB signaling protein expression was conducted through western blot analysis. All data are expressed as the mean ± SEM of three separate experiments. ^###p<0.001, ^##p<0.01, and ^#p<0.05 vs. untreated group (none); ***p<0.001, **p<0.01, and *p<0.05 vs. LPS-only treated group.

Molecular modeling

The molecular modeling studies aimed to investigate the impact of benzylideneacetophenone on various cellular processes, including cell viability, LPS-induced nitric oxide generation, and cytokine production, in order to gain insights into its anti-inflammatory properties. Table 1 presents the results of the molecular modeling analysis conducted on the benzylideneacetophenone derivatives, JCII. While the study did not encompass a wide range of compounds, it yielded significant findings. Notably, the HOMO and LUMO energies fell within the range of -5.99 to -5.75 eV and -2.05 to -1.61 eV, respectively. Last research results showed that the gap between HOMO and LUMO was inversely proportional to nitric oxide production ability in LPS-treated BV2 cells (Jung et al., 2008).

Specifically, JCII-11 exhibited the highest HOMO-LUMO gap (4.14 eV), indicating a propensity for rapid electron and radical transfer between these energy levels. This characteristic could account for the observed potent free radical scavenging activity of JCII-11. Furthermore, these findings establish a close correlation between the electro density of JCII-11 and its resonance effect, as depicted in Fig. 6. Based on these results, the HOMO-LUMO gap emerges as a crucial parameter for selecting potential anti-inflammatory compounds from the evaluated chalcone derivatives.

Figure 6. Chemical structures and HOMO-LUMO maps of JCII-8,10,11 compounds, benzylideneacetophenone derivatives. HOMO, highest occupied molecular orbital; LUMO, lowest unoccupied molecular orbital.

The administration of JCII-8,10,11 resulted in a reduction of iNOS and COX-2 protein levels in mice injected with LPS

To assess the in vivo anti-inflammatory effects of JCII-8,10,11, a study involved administering JCII-8,10,11 (30 mg/kg) via intraperitoneal injection to ICR mice for four consecutive days, with subsequent LPS administration on the final day. After three days of LPS injection, tissue samples from the frontal cortex of the brain and kidneys were collected from the LPS-treated mice for the purpose of examining the protein expression of iNOS and COX-2 through western blot analysis. As depicted in Fig. 7, the systemic inflammation triggered by LPS resulted in an increased expression of iNOS and COX-2 in both the brain frontal cortex and kidneys. Remarkably, pre-treatment with all three JCII-8,10,11 compounds notably curtailed the heightened expression of iNOS and COX-2 in both regions (Fig. 7A, 7B). These collective findings affirm that JCII-8,10,11 possess significant anti-inflammatory potential in an in vivo context.

Figure 7. Effects of JCII-8,10,11 on iNOS and COX-2 protein expression in ICR mice injected with LPS. Male ICR mice were subjected to intraperitoneal injections of JCII-8,10,11 at a dose of 30 mg/kg once daily for four consecutive days, followed by intraperitoneal injection of LPS 1 h after the last JCII-8,10,11 administration. After a 3-day interval, the mice were euthanized, and tissues from the frontal cortex of the brain (A) and kidney (B) were collected for subsequent western blot analysis to assess the protein expression levels of iNOS and COX-2. The data are presented as mean ± SEM from three independent experiments. ^###p<0.001 vs. untreated group (none); ***p<0.001, **p<0.01, and *p<0.05 vs. LPS-only treated group.

The present investigation is dedicated to unraveling the anti-inflammatory potential harbored by JCII-8,10,11, notable derivatives of benzylideneacetophenone originating from the reservoir of natural compounds, specifically Yakuchinone B, an entity renowned for its established anti-inflammatory attributes, as extracted from Alpinia oxyphylla seeds (Chun et al., 2002). In prior investigations, it was established that JCII-8 compounds possess both anti-inflammatory and neuroprotective properties (Jang et al., 2009). Through an intricate interplay of in vitro and in vivo assessments, the study undertakes an exploration of JCII-8,10,11’s impact upon inflammatory mediators incited by the orchestration of lipopolysaccharide (LPS) within microglial domains.

The application of LPS stimulation stands as a well-entrenched technique within the scientific milieu, commonly harnessed to instigate inflammatory scenarios across diverse research models (Noh et al., 2014; Banks et al., 2015; Roy et al., 2016; Liu et al., 2018; Yang et al., 2020). The engagement of LPS triggers the activation of Toll-like receptor 4 (TLR-4) within the microglial landscape, engendering the production of potent pro-inflammatory agents such as TNF-α, COX-2, and NO production (Park et al., 2009; Park and Lee, 2013; Maldonado et al., 2016). In Fig. 1, the microglia cell line BV2 activated with LPS stimulation had increased the level of NO products as in previous studies (Lieb et al., 2003; Sheng et al., 2011), and this increase was reversed by pretreatment of JCII-8,10,11.

Within the NF-κB signaling pathway, iNOS stands as a critical downstream effector, primarily recognized for its role in nitric oxide production (Aktan, 2004). Elevated iNOS levels lead to an excessive nitric oxide output, which inflicts damage upon nucleic acids, proteins, and lipids (Bogdan, 2001). Furthermore, NF-κB-triggered COX-2, an enzyme that regulates prostaglandin production, plays a crucial role in modulating inflammation. Consequently, the heightened presence of iNOS and COX-2 intensifies oxidative stress and disrupts typical physiological processes (Filipović et al., 2017).

To gauge the impact of JCII-8,10,11 on inflammation, this paper focuses on iNOS, TNF-α, IL-6, IL-1β, and COX-2, which are representative inflammatory mediators. It is assessed how JCII-8,10,11 influenced the mRNA levels and protein expression of each target. The findings demonstrated a reduction in the production of NO, COX-2, and cytokines in LPS-stimulated BV2 cells (Fig. 2), accompanied by a significant inhibition in the expression of inflammatory-related proteins (Fig. 3). Consequently, JCII-8,10,11’s anti-inflammatory properties have been substantiated.

Subsequent experiments were carried out to validate whether JCII 8,10,11 treatment fundamentally hinders NF-κB translocation into the nucleus via the MAPK signaling pathway. NF-κB oversees the expression of genes associated with both inflammatory and immune responses and can be activated by a variety of stimuli including LPS, oxidative stress, cytokines, and various mitogens (Oeckinghaus and Ghosh, 2009; Liu et al., 2017; Natarajan et al., 2018). Notably, iNOS and COX-2 are enzymes under the regulatory purview of NF-κB. Initially, it was confirmed that JCII-8,10,11 treatment proceeds through the MAPKs signaling pathway. The phosphorylated states of JNK, ERK1/2, and p38, which exhibited an increase in LPS-stimulated BV2 cells, were suppressed with prior JCII-8,10,11 pretreatment (Fig. 4). Furthermore, JCII-8,10,11 impeded the NF-κB signaling pathway and its corresponding transcriptional activity in LPS-stimulated BV2 microglia (Fig. 5). Consequently, prior JCII-8,10,11 pretreatment thwarted the expression of inflammatory mediators by impeding the nuclear translocation of NF-κB via the MAPKs signaling pathway in LPS-stimulated microglia.

The in vivo validation of JCII-8,10,11’s anti-inflammatory properties was further substantiated. Using an LPS-induced mouse model, alterations in the expression of iNOS, COX-2, and pro-inflammatory mediators were affirmed in both the brain cortex and kidney of the mice (Wu et al., 2015; Mittli et al., 2023). Notably, it was demonstrated that the upsurge in inflammatory mediators induced by LPS stimulation was effectively curtailed by the administration of all three compounds, JCII-8,10,11 (Fig. 7).

The study effectively showcased the anti-inflammatory prowess of JCII-8,10,11 in both in vitro and in vivo. The research unveiled that JCII-8,10,11 decrease inflammatory mediators by engaging the MAPKs signaling pathway, thus impeding the translocation of NF-kB into the nucleus. This collective evidence strongly indicates substantial anti-inflammatory efficacy across cells and mice for all three variants of JCII-8,10,11. Consequently, it can be deduced that JCII 8,10,11 hold significant promise as a wellspring of therapeutic agents for tackling inflammation-related maladies.

This research was supported by Ewha Womans University scholarship of 2021 and Ewha Graduate Research Fellowship (M.K.).