Biomolecules & Therapeutics 2024; 32(4): 499-507  https://doi.org/10.4062/biomolther.2024.054
Inhibitory Action of 1,3,5-Trihydroxybenzene on UVB-Induced NADPH Oxidase 4 through AMPK and JNK Signaling Pathways
Chaemoon Lim1,†, Mei Jing Piao2,†, Kyoung Ah Kang2, Pincha Devage Sameera Madushan Fernando2, Herath Mudiyanselage Udari Lakmini Herath2, Dae Whan Kim1, Joo Mi Yi3, Yung Hyun Choi4 and Jin Won Hyun2,*
1Department of Orthopedic Surgery, Jeju National University Hospital, College of Medicine, Jeju National University, Jeju 63241,
2Department of Biochemistry, College of Medicine, and Jeju Research Center for Natural Medicine, Jeju National University, Jeju 63243,
3Department of Microbiology and Immunology, Inje University College of Medicine, Busan 47392,
4Department of Biochemistry, College of Oriental Medicine, Dongeui University, Busan 47340, Republic of Korea
*E-mail: jinwonh@jejunu.ac.kr
Tel: +82-64-754-3838, Fax: +82-64-702-2687
The first two authors contributed equally to this work.
Received: April 3, 2024; Revised: May 23, 2024; Accepted: May 24, 2024; Published online: June 25, 2024.
© The Korean Society of Applied Pharmacology. All rights reserved.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Specific sensitivity of the skin to ultraviolet B (UVB) rays is one of the mechanisms responsible for widespread skin damage. This study tested whether 1,3,5-trihydroxybenzene (THB), a compound abundant in marine products, might inhibit UVB radiation-induced NADPH oxidase 4 (NOX4) in both human HaCaT keratinocytes and mouse dorsal skin and explore its cytoprotective mechanism. The mechanism of action was determined using western blotting, immunocytochemistry, NADP+/NADPH assay, reactive oxygen species (ROS) detection, and cell viability assay. THB attenuated UVB-induced NOX4 expression both in vitro and in vivo, and suppressed UVB-induced ROS generation via NADP+ production, resulting in increased cell viability with decreased apoptosis. THB also reduced the expression of UVB-induced phosphorylated AMP-activated protein kinase (AMPK) and phosphorylated c-Jun N-terminal kinase (JNK). THB suppressed UVB-induced NOX4 expression and ROS generation by inhibiting AMPK and JNK signaling pathways, thereby inhibiting cellular damage. These results showed that THB could be developed as a UV protectant.
Keywords: 1,3,5-Trihydroxybenzene, Ultraviolet B, NADPH oxidase, AMP-activated protein kinase, c-Jun N-terminal kinase
INTRODUCTION

Ultraviolet (UV) light fills the electromagnetic spectrum of 100-400 nm, which can be categorized by the wavelengths UVA (320-400 nm), UVB (280-320 nm), and UVC (100-280 nm). UVA has strong penetrating power, can reach the dermis of the skin, and acts on blood vessels and other tissues. UVB has medium penetrating power, can reach the epidermis of the skin, and can cause erythema in the epidermis. UVC has weak penetration and rarely reaches the skin (Blatchley Iii et al, 2023). Skin exposure to UV light results in numerous biological effects, many of which are detrimental. The keratinocytes of the epidermis are the main target of UVB radiation, leading to erythema, premature aging of the skin, and even non-melanoma skin cancer (Tang et al., 2024).

NADPH oxidases (NOXs), the main reactive oxygen species (ROS)-producing system, comprise seven members: NOX1 to NOX5, dual oxidase (DUOX) 1, and DUOX2. NOX4 widely exists in vascular cells, kidney cells, osteoclasts, and skin epidermal cells (Montezano et al., 2011; Li et al., 2018; Yang et al., 2018; Zhang et al., 2023). NOX4 releases hydrogen peroxide (H2O2), which is different from other NOX family members, which release superoxide (Nisimoto et al., 2014). NOX4 is highly upregulated when mouse or human skin keratinocytes are exposed to UVB radiation (Rahman et al., 2011; Li et al., 2018; Park et al., 2019). NOX4-derived ROS are regulated by various signaling pathways, including adenosine monophosphate-activated protein kinase (AMPK) or c-Jun N terminal kinase (JNK) (Papadimitriou et al., 2014; Tobar et al., 2014). AMPK is a serine-threonine kinase that primarily coordinates the need for energy and metabolism (Crane et al., 2021), maintains cellular metabolic homeostasis through the regulation of mitochondrial ROS (Rabinovitch et al., 2017), and regulates apoptosis (Zhang et al., 2020). Recent report has shown that high glucose induces oxidative stress in vascular smooth muscle cells by modulating the PKCζ-AMPK-NOX4 pathway (Wang et al., 2020). The MAPK signaling cascade is an important target of UV light in the regulation of UV-induced cellular responses, including the JNK signaling pathway (Zhai et al., 2015). Induction of mitochondrial NOX4 by activated JNK signaling leads to mitochondrial dysfunction and oxidative stress, thus inducing apoptosis (Ji et al., 2018). Based on these studies, we hypothesized that reducing NOX4 levels in human skin keratinocytes by modulating the AMPK or JNK pathways using pharmacological agents was a beneficial strategy for preventing skin diseases.

Phlorotannins, mainly found in brown algae, are derivatives of a class of 1,3,5-trihydroxybenzene (THB). Their biological effects are diverse, including anti-oxidative, anti-bacterial, and anti-diabetic properties (Abdelhamid et al., 2018; Kim et al., 2018; Kumar et al., 2022). In addition, we have reported that THB attenuates matrix metalloproteinase-1 activity and inhibits UVB-induced oxidative stress damage to intracellular macromolecules (Kim et al., 2012; Piao et al., 2012, 2014, 2015). Although NOX4 is an enzyme mediating UVB-induced ROS production, the preventive effect of THB on UVB-induced NOX4 has not been studied in detail. This study evaluated the protective role of THB against UVB-induced NOX4 level in vitro and in vivo.

MATERIALS AND METHODS

Reagents and sources

1,3,5-Trihydroxybenzene (THB), diphenyleneiodonium chloride (DPI), 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA), GLX351322, compound C, SP600125, Hoechst 33342 dye, and actin antibody were obtained from Sigma-Aldrich Ltd. (St. Louis, MO, USA). NOX4 (H-300) antibody (sc-30141) and UltraCruz® mounting medium were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Thiazoyl blue tetrazolium bromide (MTT) was bought from Amresco LLC (Cleveland, OH, USA). The DUOX1 antibody (PA5-85452) was purchased from Thermo Fisher Scientific, Inc. (Carlsbad, CA, USA). The antibodies against phospho-AMPK (Thr172) (#2531), AMPK (#2532), phospho-acetyl-coenzyme A carboxylase (phospho-ACC) (Ser79) (#3661), phospho-SAPK/JNK (Thr183/Tyr185) (#9251), SAPK/JNK (#9252), phospho-c-Jun (Ser73) (#9164), and c-Jun (60A8) (#9165) were purchased from Cell Signaling Technology (Beverly, MA, USA). The NOX1 antibody (NBP-31546) was purchased from Novus Biologicals (Cambridge, UK). The ACC antibody (ab45174) and NOX2 antibody (ab80897) were purchased from Abcam (Cambridge, MA, USA). All other chemicals and reagents were of analytical grade.

Cell culture and UVB exposure

Human keratinocytes (HaCaT; Cell Lines Service, Eppelheim, Germany) were cultured in Dulbecco’s modified Eagle’s medium containing 10% heat-inactivated fetal bovine serum (Life Technologies, Carlsbad, CA, USA) and an antibiotic-antimycotic solution (Life Technologies) at 37°C, 5% CO2, and 95% humidity. The cells were irradiated with UVB light at 30 mJ/cm2 using a UVB light source and irradiation method as previously reported (Piao et al., 2015).

Animal treatment and UVB exposure

Seven-week-old male Balb/c mice (Orient Bio Inc., Seongnam, Korea) were raised at 25-28°C under a 12 h light/dark cycle and provided with a standard diet and drinking water. The mice were randomly divided into four groups untreated normal control (PBS), UVB (60 mJ/cm2), THB (10 mg/mL)+UVB (60 mJ/cm2), and THB (50 mg/mL)+UVB (60 mJ/cm2), with five mice per group. After shaving the hair on the back of the mouse using a hair removal device, PBS or THB was applied to the back skin, which was exposed to UVB. Exposure to UVB once daily was repeated for a total of seven days, and the study was conducted 24 h after the last exposure. All experimental procedures were performed according to the Jeju National University (Jeju, Korea) guide for laboratory animal care and use.

Cell viability assay

Cells were treated with different THB concentrations (2.5, 5, 10, 20, 40, and 80 μM), irradiated with 30 mJ/cm2 of UVB, and incubated for 24 h. Alternatively, cells (1.5×104 cells/well) were treated with 10 μM THB, 5 μM GLX351322, 5 μM compound C, or 5 μM SP600125, incubated for 1 h, irradiated with 30 mJ/cm2 UVB, and incubated at 37°C for 24 h. MTT assay was assessed at the absorbance at 540 nm using a microplate reader (Molecular Devices, Sunnyvale, CA, USA).

NOXs mRNA detection

For quantitative real-time polymerase chain reaction (qRT-PCR), the PrimeScript™ RT reagent kit (TaKaRa, Da-lian, China) was used to produce cDNA. The qRT-PCR conditions were as follows: pre-denaturation for 10 min at 95°C; 40 cycles at 95°C for 15 s; and at 60°C for 1 min on a Bio-Rad iQ5 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). The primer pairs (Bionics, Seoul, Korea) are shown in Table 1.

Table 1 Primer sequences

GenePrimer
(human)
Sequence (5′-3′)
NOX1SenseCAATCTCTCTCCTGGAATGGCATCCT
AntisenseCCTGCTGCTCGGATATGAATGGAGAA
NOX2SenseAAGGCTTCAGGTCCACAGAGGAAA
AntisenseAGACTTTGTATGGACGGCCCAACT
NOX3SenseACCGTGGAGGAGGCAATTAGACAA
AntisenseCAGGTTGAAGAAATGCGCCACGAT
NOX4SenseAGCAGAGCCTCAGCATCTGTTCTT
AntisenseTGGTTCTCCTGCTTGGAACCTTCT
NOX5SenseCCTCCTCATGTTCATCTGCTCCAGTT
AntisenseAGGAGGTAGGACAGGTGAGTCCAATA
DUOX1SenseGCAGGACATCAACCCTGCACTCTC
AntisenseCTGCCATCTACCACACGGATCTGC
DUOX2SenseCCGGCAATCATCTATGGAGGT
AntisenseTTGGATGATGTCAGCCAGCC
β-ActinSenseAGGCCTCGCCTTTGCCGA
AntisenseCTGGTGCCTGGGGCG


Protein detection

For western blotting, cells and mouse dorsal skin tissues were lysed using the PRO-PREPTM protein extraction solution (iNtRON Biotechnology, Seongnam, Korea) and quantified using a Quant-iT™ protein assay kit (Thermo Fisher Scientific, Inc.). For electrophoresis, 30 μg of protein samples were separated via SDS-PAGE, transferred to nitrocellulose membranes, and the membranes were incubated with the following primary antibodies (dilution ratio 1:1000): NOX1, NOX2, NOX4, DUOX1, phospho-AMPK, AMPK, phospho-ACC, ACC, phospho-JNK, JNK, phospho-c-Jun, c-Jun, and actin. Subsequently, goat anti-rabbit or mouse IgG secondary antibody conjugated with horseradish peroxidase (Invitrogen) was added and incubated. Protein expression was detected using Amersham enhanced chemiluminescence western blot detection reagent (GE Healthcare, Buckinghamshire, UK). For immunocytochemistry, cells (0.6×105 cells/well) were seeded in a 4-well chamber slide, treated with 10 μM of THB, 5 μM compound C, and 5 μM SP600125 for 1 h, and then irradiated with UVB light. Fixed cells plated on coverslips were incubated with anti-NOX4 antibody, followed by FITC-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA). The stained cells were mounted onto microscope slides in a mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, USA). Images were collected using the LSM 510 program on a confocal microscope (Carl Zeiss, Oberkochen, Germany).

Intracellular ROS measurement

According to the time (1, 3, 6, 12, 24 h), the cells were treated with either 30 mJ/cm2 UVB irradiation or treated with 10 μM THB, or/and 5 μM GLX351322 followed by irradiation with 30 mJ/cm2 UVB, and incubated for 12 h. Cells were analyzed using a flow cytometer (Becton Dickinson Co., Mountain View, CA, USA) or a fluorescence spectrophotometer (PerkinElmer Co., Foster City, CA, USA) after staining with the H2DCFDA fluorescent dye for 30 min. HyPer is the first fully genetically encoded fluorescent sensor capable of detecting intracellular H2O2 (Rezende et al., 2018). Cells were transfected with the plasmid pHyPer-cyto or pHyPer-dMito (Evrogen, Moscow, Russia), which encodes a derivative of the H2O2-specific sensor protein Hyper tagged with cytoplasmic and mitochondrial fluorescence signal peptide sequence. The green fluorescence signal from the HyPer sensor was detected using a confocal microscope (Carl Zeiss).

NADP+/NADPH assay

Following the instruction of the NADP+/NADPH assay kit (Abcam), samples were extracted from the cell pellets and mouse dorsal skin tissue using the extraction buffer and deproteinized using the spin column. The reaction mix was added and the samples were incubated for 5 min at 20°C to convert NADP+ to NADPH. Then, the NADPH developer was added and further incubated for 4 h during which the samples were analyzed multiple times using a microplate reader (Molecular Devices).

Apoptotic body detection

Hoechst 33342 fluorescent dye was added and images were taken for analysis. The apoptotic index is the value of the total number of apoptotic bodies divided by the total number of intact cells.

Statistical analysis

The values represented the mean ± standard error in triplicate tests. Analysis of variance was performed on the obtained data and Tukey’s test was performed to determine the difference between the means. A value of p<0.05 was considered statistically significant.

RESULTS

THB prevents UVB-induced NOX4 expression in HaCaT keratinocytes and mouse dorsal skin

We estimated the cell viability of THB at various concentrations and found that THB showed no cytotoxicity up to 40 µM (Fig. 1A). In addition, the cytoprotective activity against UVB showed concentrations from 10 to 40 μM (Fig. 1A). Our previous study demonstrated that 10 μM THB exhibited a ROS scavenging effect against UVB-induced damage (Kim et al., 2012). Therefore, 10 μM THB was used as the optimal concentration for further investigation. To examine UVB exposure-induced NOXs expression in human keratinocytes, HaCaT cells were irradiated with 30 mJ/cm2 UVB and incubated for 3 h, and NOXs gene expression was analyzed using qRT-PCR. UVB exposure induced a significant increase in the expression of NOX1, NOX2, NOX4, and DUOX1 at 3 h (Fig. 1B). The mRNA expression pattern of NOXs in HaCaT cells was consistent with the protein expression in cells (Fig. 1C). Many studies have evaluated NOX1, NOX2, and DUOX1 in HaCaT cells (Chamulitrat et al., 2004; Glady et al., 2018; Pató et al., 2023); however, NOX4 is relatively poorly studied in HaCaT cells. Therefore, we performed the following experiments, focusing on NOX4. NOX4 production was detected at different time points to verify its expression under UVB exposure. The mRNA expression of NOX4 was maintained up to 24 h and was highest at 3 h (Fig. 1D). THB significantly prevented UVB-induced changes in mRNA expression (Fig. 1D). Interestingly, the decrease in the expression of NOX4 mRNA was time-dependent, even when treated with THB alone (Fig. 1D). In agreement with the qRT-PCR results, NOX4 protein expression was maintained up to 12 h and was highest at 3 h (Fig. 1E). The protein expression of NOX4 after THB treatment was consistent with the qRT-PCR result (Fig. 1F), confirmed through immunofluorescence analysis of the cells (Fig. 1G). In support of the in vitro result, the in vivo result revealed that the skin had a higher level of NOX4 protein in mice exposed to UVB radiation (60 mJ/cm2) than that in control mice, and that pretreatment with THB (10 and 50 mg/mL) decreased the protein expression level in UVB-exposed mouse dorsal skin (Fig. 1H). Thus, THB prevented UVB-induced NOX4 expression in both human HaCaT keratinocytes and mouse dorsal skin.

Figure 1. THB prevents UVB-induced NOX4 expression in HaCaT keratinocytes and mouse dorsal skin. (A) Cells were seeded, pre-treated with THB at 2.5, 5, 10, 20, 40, and 80 μM for 1 h, and irradiated with 30 mJ/cm2 UVB. After 24 h, cell viability was determined using the MTT assay. *p<0.05 vs. control group; #p<0.05 vs. UVB group. (B) Cells were irradiated with 30 mJ/cm2 UVB and incubated for 3 h. The mRNA expression of various NOXs was assessed via qRT-PCR. *p<0.05 vs. control group. (C) NOX1, NOX2, NOX4, and DUOX1 protein expression was analyzed via western blotting. Actin was used as the loading control. *p<0.05 vs. control group. (D) Cells were pre-incubated with 10 μM THB for 1 h, and incubation was continued after irradiation with 30 mJ/cm2 UVB for 1, 3, 6, 12, and 24 h. The mRNA expression of NOX4 was assessed via qRT-PCR. *p<0.05 vs. control group; #p<0.05 vs. UVB group. (E-G) NOX4 protein expression was analyzed (E, F) using western blotting and (G) immunocytochemistry. Actin was used as the loading control. *p<0.05 vs. control group; #p<0.05 vs. UVB group. DAPI staining was used to determine the location and number of nuclei. (H) Mice were irradiated with 60 mJ/cm2 of UVB, and THB was applied to the skin daily for 3 days. NOX4 protein expression level was determined via western blotting. Actin was used as the loading control. *p<0.05 vs. control group; #p<0.05 vs. UVB group.

THB prevents UVB-induced intracellular ROS production via NADPH oxidase

After UVB irradiation, ROS production gradually increased in a time-dependent manner, which was the highest at 12 h; however, THB decreased ROS production induced by UVB irradiation (Fig. 2A). ROS production detected using fluorescence spectrophotometry showed that UVB exposure stimulated ROS production (124%) compared with the control (100%), whereas treatment with THB or DPI (a NOX inhibitor) in cellular ROS production reduced to 113% and 107%, respectively (Fig. 2B). To show that the types of ROS induced by UVB include H2O2 produced by NOX4, we transfected pHyPer-cyto and pHyPer-dMito vectors and observed the H2O2 level through a confocal microscope; obvious fluorescence was observed in the UVB group, but rarely appeared in the THB+UVB group (Fig. 2C). Subsequently, we determined the NADP+/NADPH ratio in cells and mouse dorsal skin tissue to detect NOX activity. UVB-exposed cells displayed a higher NADP+/NADPH ratio compared to the control group, whereas the THB+UVB group showed a significantly decreased NADP+/NADPH ratio compared to UVB-exposed group (Fig. 2D). In addition, THB significantly decreased the NADP+/NADPH ratio that was elevated by UVB radiation in mouse dorsal skin tissue (Fig. 2E). These results indicated that THB inhibited UVB-induced intracellular ROS levels by inhibiting NOX activity.

Figure 2. THB prevents UVB-induced NOX activity. (A) Cells were treated with 10 μM of THB for 1 h, followed by 30 mJ/cm2 UVB radiation and incubation for 1, 3, 6, 12, and 24 h. The intracellular ROS levels were detected via flow cytometry after staining with the H2DCFDA reagent. *p<0.05 vs. control group; #p<0.05 vs. UVB group. (B) Cells were treated with 10 μM of THB or 1 mM DPI for 1 h, followed by UVB radiation, and incubated for 12 h. The intracellular ROS levels were detected via fluorescence spectrophotometry after staining with the H2DCFDA reagent. *p<0.05 vs. control group; #p<0.05 vs. UVB group. (C) Cells were transfected with pHyPer-cyto or pHyPer-dMito vectors, and intracellular H2O2 level was detected using a confocal microscope. (D, E) NOX activity was assessed using NADP+/NADPH assay kit (D) in HaCaT cells and (E) in the mouse dorsal skin tissue. *p<0.05 vs. control group; #p<0.05 vs. UVB group.

THB prevents UVB-induced cell death by inhibiting NOX activation

To evaluate whether THB scavenges ROS by inhibiting NOX4 expression, the effects of the NOX4 inhibitor GLX351322 and THB on ROS production after UVB exposure were compared. GLX351322 or THB significantly scavenged UVB-induced ROS production, and there was no significant difference in the scavenging effects between them (Fig. 3A). This suggested that the scavenging of UVB-induced ROS by THB was likely accomplished by blocking NOX4. Analysis of fluorescence image taken using a fluorescence microscope confirmed this conclusion (Fig. 3B). Excessive cellular ROS can affect cell sensitivity to UVB radiation-induced apoptosis. As illustrated in Fig. 3C, cells exposed to 30 mJ/cm2 UVB showed an increase in the number of apoptotic bodies compared to that in the control cells; however, 10 μM THB or/and 5 μM GLX351322 demonstrated cytoprotective effects, as evidenced by a decrease in the number of apoptotic bodies. Additionally, cell viability after UVB exposure was reduced by more than half compared to that in the control group. However, THB or/and GLX351322 significantly restored cell viability by more than 10% (Fig. 3D). These results indicated that THB prevented UVB-induced cell damage by inhibiting the NOX4 pathway.

Figure 3. THB prevents UVB-induced ROS production and cell death by inhibiting NOX4 activity. Cells were treated with THB (10 µM) or/and GLX351322 (5 µM) for 1 h before 30 mJ/cm2 UVB exposure. (A, B) ROS levels were assessed via (A) flow cytometry (FI: fluorescence intensity) and (B) fluorescence microscopy after H2DCFDA staining. (C) Cell apoptosis was monitored using Hoechst 33342 nuclear staining. *p<0.05 vs. control; #p<0.05 vs. UVB group. (D) Cell viability was evaluated using MTT assay. *p<0.05 vs. control; #p<0.05 vs. UVB group.

THB prevents UVB-induced NOX4 expression via the AMPK and JNK signaling pathways

To understand the mechanism of UVB-induced NOX4 expression, specific inhibitors were used to detect whether AMPK or JNK was involved in NOX4 expression. The expression of AMPK and its downstream signaling substrate, ACC, or JNK and its downstream activator c-Jun were detected at different time points to verify its expression under UVB stimulation. The expression of phospho-AMPK and phospho-ACC proteins were increased compared to the control groups up to 3 h and were highest at 0.5 and 1 h, respectively (Fig. 4A). Similarly, the expression of phospho-JNK and phospho-c-Jun proteins also increased within 3 h and were highest at 0.5 and 1 h, respectively (Fig. 4B). THB and the AMPK inhibitor, compound C, inhibited the levels of UVB-induced phospho-AMPK and phospho-ACC, as well as NOX4 expression (Fig. 4C). THB and the JNK inhibitor, SP600125, also inhibited UVB-induced phospho-JNK and its downstream signaling substrate, c-Jun, as well as NOX4 expression (Fig. 4D). Similar results were obtained for NOX4 expression via cell immunocytochemistry after treatment with AMPK and JNK inhibitors (Fig. 4E, 4F).

Figure 4. THB prevents UVB-induced NOX4 expression via the AMPK and JNK signaling pathways. (A, B) Cells were irradiated with 30 mJ/cm2 UVB and incubated for 0.5, 1, 3, and 6 h. (A) Phospho-AMPK, phospho-ACC, (B) phospho-JNK, and phospho-c-Jun protein expressions were analyzed via western blotting. AMPK, ACC, JNK, c-Jun, and actin were used as loading controls. (C) Cells were incubated with 10 μM THB or 5 μM compound C for 0.5 h, and then irradiated with UVB. Western blotting analyses of phospho-AMPK, phospho-ACC, and NOX4 protein expression were carried out. AMPK, ACC, and actin were used as the loading control. (D) Cells were incubated with 10 μM THB or 5 μM SP600125 for 0.5 h and then irradiated with UVB. Western blotting analyses of phospho-JNK, phospho-c-Jun, and NOX4 protein expression were assessed. JNK, c-Jun, and actin were used as the loading control. (E, F) Analysis of NOX4 expression was performed via immunocytochemistry, and DAPI staining indicated the location and number of nuclei.

THB prevents UVB-induced ROS production and cell death via the AMPK and JNK signaling pathways

AMPK and JNK inhibitors significantly reduced the UVB-induced ROS production, and the effect of THB was similar (Fig. 5A, 5B). Examination of apoptosis using Hoechst 33342 nuclear staining showed that compound C, SP600125, and THB significantly declined the index of UVB-induced apoptotic bodies (Fig. 5C). The cell viability results detected via the MTT assay showed that THB significantly inhibited UVB-induced cell viability, and compound C and SP600125 also inhibited UVB-induced cell viability (Fig. 5D, 5E). These results indicated that THB exerted its cytoprotective effect through the AMPK and JNK signaling pathways.

Figure 5. THB prevents UVB-induced cell death via the AMPK and JNK signaling pathways. Cells were treated with 10 μM compound C, 10 μM SP600125, or 10 μM THB for 1 h, respectively, and exposed to 30 mJ/cm2 UVB. (A, B) ROS levels were assessed via (A) fluorescence spectrophotometry and (B) confocal microscopy after H2DCFDA staining. *p<0.05 vs. control; #p<0.05 vs. UVB group. (C) Cell apoptosis was monitored using Hoechst 33342 staining. *p<0.05 vs. control; #p<0.05 vs. UVB group. (D, E) Cell viability was evaluated using the MTT assay. *p<0.05 vs. control; #p<0.05 vs. UVB group.
DISCUSSION

NOX is an important source of ROS that transfers electrons through the plasma membrane to generate ROS. NOX-dependent ROS generation is activated by a wide range of chemical, physical, environmental, and biological factors, among which UV rays are a representative factor. Excessive UV rays undergo photo-oxidation with oxygen molecules in the skin to generate ROS. Among the NOX family members, NOX1, 2, and 5 are the main sources of superoxide anion, whereas NOX4 predominantly generates hydrogen peroxide from molecular oxygen using NADPH as an electron donor (Cipriano et al., 2023). Our study showed that NOX family proteins in HaCaT keratinocytes were expressed under UVB radiation, and the expression levels of NOX1, NOX2, and DUOX1 were higher than those of NOX4. Multiple studies have examined the NOX family in HaCaT cells; however, reports highlighting the signaling pathway of NOX4 expression are limited. Therefore, this research focused on NOX4 induced by UVB and its signal transduction system.

THB is an antioxidant naturally present in marine products, with many functions and effects, such as protecting cells against oxidative stress, delaying aging, and improving immune function (Piao et al., 2014; Cao et al., 2020; Pradhan and Ki, 2023).

ROS are highly reactive molecules that can react to cell membranes, proteins, and DNA and cause oxidative damage, promote cell apoptosis, and lead to cell death. ROS include superoxide anion, hydroxyl radical, and hydrogen peroxide. Each ROS has different intrinsic chemical properties, which dictate its reactivity and preferred biological targets. Both the production and elimination of these molecules are controlled by complex regulatory mechanisms. Our previous study demonstrated that THB scavenged the superoxide anion, hydroxyl radical, and hydrogen peroxide in a cell-free system; this increased the activity or expression of catalase, a hydrogen peroxide-removing antioxidant enzyme, in lung fibroblast cells (Kang et al., 2006). Here, we demonstrated that THB significantly scavenged UVB-induced intracellular ROS, and the NOX4 inhibitor GLX351322 inhibited UVB-induced ROS production, with no significant difference to the scavenging effect of THB. This demonstrated that NOX4 was involved in UVB-induced ROS production.

Studies have shown that AMPK is an important player in UV-induced skin cell damage and that UVB activates AMPK in human HaCaT keratinocytes (Han et al., 2024). Furthermore, the AMPK-NOX4 pathway regulates oxidative stress (Wang et al., 2020). We hypothesized that inhibition of the AMPK signaling pathway by THB might promote the prevention of UVB-mediated NOX4 production. In our system, AMPK was activated by UVB stimulation early (0.5 h), but it was largely inhibited by THB. In addition, NOX4 and ROS produced via UVB irradiation were effectively inhibited by the AMPK inhibitor, suggesting that UVB-induced ROS generation was achieved through the AMPK signaling pathway. Many studies have shown the existence of a JNK-ROS positive feedback loop, where JNK induces ROS production (Fey et al., 2012; Kim et al., 2014). In the present study, we observed that JNK activation by UVB occurred early (0.5 h); however, it was attenuated by THB. Moreover, NOX4 and ROS produced by UVB irradiation were effectively abolished by the JNK inhibitor, suggesting that UVB-induced ROS production was induced through the JNK signaling pathway. Notably, NOX4-derived ROS generated by AMPK or JNK signaling activation induced apoptosis and cell death in our system, which was effectively suppressed by THB. THB exhibited protective effects similar to those of the AMPK or JNK inhibitors on UVB-induced NOX4 expression, ROS production, and cell death. In conclusion, this study demonstrated that inhibition of NOX4 expression appeared to be an important process through which THB protected the skin from UVB-induced damage, and this mechanism depended on the activity of the AMPK and JNK signaling pathways.

ACKNOWLEDGMENTS

This work was supported by a research grant from Jeju National University Hospital in 2022.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

References
  1. Abdelhamid, A., Jouini, M., Bel Haj Amor, H., Mzoughi, Z., Dridi, M., Ben Said, R. and Bouraoui, A. (2018) Phytochemical analysis and evaluation of the antioxidant, anti-inflammatory, and antinociceptive potential of phlorotannin-rich fractions from three mediterranean brown seaweeds. Mar. Biotechnol. 20, 60-74.
    Pubmed CrossRef
  2. Blatchley Iii, E.R., Brenner, D. J., Claus, H., Cowan, T. E., Linden, K. G., Liu, Y., Mao, T., Park, S. J., Piper, P. J., Simons, R. M. and Sliney, D. H. (2023) Far UV-C radiation: an emerging tool for pandemic control. Crit. Rev. Environ. Sci. Technol. 53, 733-753.
    CrossRef
  3. Cao, L., Lee, S. G., Lim, K. T. and Kim, H. R. (2020) Potential anti-aging substances derived from seaweeds. Mar. Drugs 18, 564.
    Pubmed KoreaMed CrossRef
  4. Chamulitrat, W., Stremmel, W., Kawahara, T., Rokutan, K., Fujii, H., Wingler, K., Schmidt, H. H. and Schmidt, R. (2004) A constitutive NADPH oxidase-like system containing gp91phox homologs in human keratinocytes. J. Invest. Dermatol. 122, 1000-1009.
    Pubmed CrossRef
  5. Cipriano, A., Viviano, M., Feoli, A., Milite, C., Sarno, G., Castellano, S. and Sbardella, G. (2023) NADPH oxidases: from molecular mechanisms to current inhibitors. J. Med. Chem. 66, 11632-11655.
    Pubmed KoreaMed CrossRef
  6. Crane, E. D., Wong, W., Zhang, H., O'Neil, G. and Crane, J. D. (2021) AMPK inhibits mTOR-driven keratinocyte proliferation after skin damage and stress. J. Invest. Dermatol. 141, 2170-2177.e3.
    Pubmed CrossRef
  7. Fey, D., Croucher, D. R., Kolch, W. and Kholodenko, B. N. (2012) Crosstalk and signaling switches in mitogen-activated protein kinase cascades. Front. Physiol. 3, 355.
    Pubmed KoreaMed CrossRef
  8. Glady, A., Tanaka, M., Moniaga, C. S., Yasui, M. and Hara-Chikuma, M. (2018) Involvement of NADPH oxidase 1 in UVB-induced cell signaling and cytotoxicity in human keratinocytes. Biochem. Biophys. Rep. 14, 7-15.
    Pubmed KoreaMed CrossRef
  9. Han, S., Liu, P., Yan, Q., Cen, Y., Wu, G., Chen, Z., Li, M., Deng, Y., Luo, F. and Lin, J. (2024) Seawater pearl hydrolysate inhibits photoaging via decreasing oxidative stress, autophagy and apoptosis of ultraviolet B-induced human skin keratinocytes. J. Cosmet. Dermatol. 23, 256-270.
    Pubmed CrossRef
  10. Ji, J. F., Jiao, W. Z., Cheng, Y., Yan, H., Su, F. and Chi, L. L. (2018) ShenFu preparation protects AML12 cells against palmitic acid-induced injury through inhibition of both JNK/Nox4 and JNK/NFκB pathways. Cell. Physiol. Biochem. 45, 1617-1630.
    Pubmed CrossRef
  11. Kang, K. A., Chae, S. W., Zhang, R., Jung, M. S., Ham, Y. M., Baik, J. S., Lee, N. H. and Hyun, J. W. (2006) Cytoprotective effect of phloroglucinol on oxidative stress induced cell damage via catalase activation. J. Cell. Biochem. 97, 609-620.
    Pubmed CrossRef
  12. Kim, A., Im, M., Yim, N. H., Kim, T. and Ma, J. Y. (2014) A novel herbal medicine, KIOM-C, induces autophagic and apoptotic cell death mediated by activation of JNK and reactive oxygen species in HT1080 human fibrosarcoma cells. PLoS One 9, e98703.
    Pubmed KoreaMed CrossRef
  13. Kim, H. J., Dasagrandhi, C., Kim, S. H., Kim, B. G., Eom, S. H. and Kim, Y. M. (2018) In vitro antibacterial activity of phlorotannins from edible brown algae, Eiseniabicyclis against streptomycin-resistant Listeria monocytogenes. Indian J. Microbiol. 58, 105-108.
    Pubmed KoreaMed CrossRef
  14. Kim, K. C., Piao, M. J., Cho, S. J., Lee, N. H. and Hyun, J. W. (2012) Phloroglucinol protects human keratinocytes from ultraviolet B radiation by attenuating oxidative stress. Photodermatol. Photoimmunol. Photomed. 28, 322-331.
    Pubmed CrossRef
  15. Kumar, L. R. G., Paul, P. T., Anas, K. K., Tejpal, C. S., Chatterjee, N. S., Anupama, T. K., Mathew, S. and Ravishankar, C. N. (2022) Phlorotannins-bioactivity and extraction perspectives. J. Appl. Phycol. 34, 2173-2185.
    Pubmed KoreaMed CrossRef
  16. Li, X. Q., Cai, L. M., Liu, J., Ma, Y. L., Kong, Y. H., Li, H. and Jiang, M. (2018) Liquiritin suppresses UVB-induced skin injury through prevention of inflammation, oxidative stress and apoptosis through the TLR4/MyD88/NF-κB and MAPK/caspase signaling pathways. Int. J. Mol. Med. 42, 1445-1459.
    Pubmed KoreaMed CrossRef
  17. Montezano, A. C., Burger, D., Ceravolo, G. S., Yusuf, H., Montero, M. and Touyz, R. M. (2011) Novel Nox homologues in the vasculature: focusing on Nox4 and Nox5. Clin. Sci. 120, 131-141.
    Pubmed CrossRef
  18. Nisimoto, Y., Diebold, B. A., Cosentino-Gomes, D. and Lambeth, J. D. (2014) Nox4: a hydrogen peroxide-generating oxygen sensor. Biochemistry 53, 5111-5120.
    Pubmed KoreaMed CrossRef
  19. Papadimitriou, A., Peixoto, E. B., Silva, K. C., Lopes, de Faria, J. M., Lopes and de Faria, J. B. (2014) Increase in AMPK brought about by cocoa is renoprotective in experimental diabetes mellitus by reducing NOX4/TGFβ-1 signaling. J. Nutr. Biochem. 25, 773-784.
    Pubmed CrossRef
  20. Park, K. H., Park, D. R., Kim, Y. W., Nam, T. S., Jang, K. Y., Chung, H. T. and Kim, U. H. (2019) The essential role of Ca2+ signals in UVB-induced IL-1β secretion in keratinocytes. J. Invest. Dermatol. 139, 1362-1372.
    Pubmed CrossRef
  21. Pató, A., Bölcskei, K., Donkó, Á., Kaszás, D., Boros, M., Bodrogi, L., Várady, G., Pape, V. F. S., Roux, B. T., Enyedi, B., Helyes, Z., Watt, F. M., Sirokmány, G. and Geiszt, M. (2023) Hydrogen peroxide production by epidermal dual oxidase 1 regulates nociceptive sensory signals. Redox Biol. 62, 102670.
    Pubmed KoreaMed CrossRef
  22. Piao, M. J., Ahn, M. J., Kang, K. A., Kim, K. C., Cha, J. W., Lee, N. H. and Hyun, J. W. (2015) Phloroglucinol enhances the repair of UVB radiation-induced DNA damage via promotion of the nucleotide excision repair system in vitro and in vivo. DNA Repair 28, 131-138.
    Pubmed CrossRef
  23. Piao, M. J., Ahn, M. J., Kang, K. A., Kim, K. C., Zheng, J., Yao, C. W., Cha, J. W., Hyun, C. L., Kang, H. K., Lee, N. H. and Hyun, J. W. (2014) Phloroglucinol inhibits ultraviolet B radiation-induced oxidative stress in the mouse skin. Int. J. Radiat. Biol. 90, 928-935.
    Pubmed CrossRef
  24. Piao, M. J., Zhang, R., Lee, N. H. and Hyun, J. W. (2012) Phloroglucinol attenuates ultraviolet B radiation-induced matrix metalloproteinase-1 production in human keratinocytes via inhibitory actions against mitogen-activated protein kinases and activator protein-1. Photochem. Photobiol. 88, 381-388.
    Pubmed CrossRef
  25. Pradhan, B. and Ki, J. S. (2023) Antioxidant and chemotherapeutic efficacies of seaweed-derived phlorotannins in cancer treatment: a review regarding novel anticancer drugs. Phytother. Res. 37, 2067-2091.
    Pubmed CrossRef
  26. Rabinovitch, R. C., Samborska, B., Faubert, B., Ma, E. H., Gravel, S. P., Andrzejewski, S., Raissi, T. C., Pause, A., St-Pierre, J. and Jones, R. G. (2017) AMPK maintains cellular metabolic homeostasis through regulation of mitochondrial reactive oxygen species. Cell Rep. 21, 1-9.
    Pubmed CrossRef
  27. Rahman, M., Kundu, J. K., Shin, J. W., Na, H. K. and Surh, Y. J. (2011) Docosahexaenoic acid inhibits UVB-induced activation of NF-κB and expression of COX-2 and NOX-4 in HR-1 hairless mouse skin by blocking MSK1 signaling. PLoS One 6, e28065.
    Pubmed KoreaMed CrossRef
  28. Rezende, F., Brandes, R. P. and Schröder, K. (2018) Detection of hydrogen peroxide with fluorescent dyes. Antioxid. Redox Signal. 29, 585-602.
    Pubmed CrossRef
  29. Tang, X., Yang, T., Yu, D., Xiong, H. and Zhang, S. (2024) Current insights and future perspectives of ultraviolet radiation (UV) exposure: friends and foes to the skin and beyond the skin. Environ. Int. 185, 108535.
    Pubmed CrossRef
  30. Tobar, N., Toyos, M., Urra, C., Méndez, N., Arancibia, R., Smith, P. C. and Martínez, J. (2014) c-Jun N terminal kinase modulates NOX-4 derived ROS production and myofibroblasts differentiation in human breast stromal cells. BMC Cancer 14, 640.
    Pubmed KoreaMed CrossRef
  31. Wang, F., Weng, Z., Lyu, Y., Bao, Y., Liu, J., Zhang, Y., Sui, X., Fang, Y., Tang, X. and Shen, X. (2020) Wheat germ-derived peptide ADWGGPLPH abolishes high glucose-induced oxidative stress via modulation of the PKCζ/AMPK/NOX4 pathway. Food Funct. 11, 6843-6854.
    Pubmed CrossRef
  32. Yang, Q., Wu, F. R., Wang, J. N., Gao, L., Jiang, L., Li, H. D., Ma, Q., Liu, X. Q., Wei, B., Zhou, L., Wen, J., Ma, T. T., Li, J. and Meng, X. M. (2018) Nox4 in renal diseases: an update. Free Radic. Biol. Med. 124, 466-472.
    Pubmed CrossRef
  33. Zhai, Y., Dang, Y., Gao, W., Zhang, Y., Xu, P., Gu, J. and Ye, X. (2015) P38 and JNK signal pathways are involved in the regulation of phlorizin against UVB-induced skin damage. Exp. Dermatol. 24, 275-279.
    Pubmed CrossRef
  34. Zhang, H., Wang, A., Li, G., Zhai, Q., Huang, Z., Wang, X., Cao, Z., Liu, L., Liu, G., Chen, B., Zhu, K., Xu, Y. and Xu, Y. (2023) Osteoporotic bone loss from excess iron accumulation is driven by NOX4-triggered ferroptosis in osteoblasts. Free Radic. Biol. Med. 198, 123-136.
    Pubmed CrossRef
  35. Zhang, J. A., Luan, C., Huang, D., Ju, M., Chen, K. and Gu, H. (2020) Induction of autophagy by baicalin through the AMPK-mTOR pathway protects human skin fibroblasts from ultraviolet B radiation-induced apoptosis. Drug Des. Devel. Ther. 14, 417-428.
    Pubmed KoreaMed CrossRef


This Article


Cited By Articles
  • CrossRef (0)

Funding Information

Services
Social Network Service

e-submission

Archives