Biomolecules & Therapeutics 2024; 32(1): 94-103  https://doi.org/10.4062/biomolther.2023.200
Doxorubicin Attenuates Free Fatty Acid-Induced Lipid Accumulation via Stimulation of p53 in HepG2 Cells
Chawon Yun1,†, Sou Hyun Kim1,†, Doyoung Kwon2,†, Mi Ran Byun3, Ki Wung Chung1, Jaewon Lee1 and Young-Suk Jung1,*
1Department of Pharmacy, College of Pharmacy, Research Institute for Drug Development, Pusan National University, Busan 46241,
2College of Pharmacy, Jeju Research Institute of Pharmaceutical Sciences, Jeju National University, Jeju 63243,
3College of Pharmacy, Daegu Catholic University, Gyeongsan 38430, Republic of Korea
*E-mail: youngjung@pusan.ac.kr
Tel: +82-51-510-2816, Fax: +82-51-513-6754
The first three authors contributed equally to this work.
Received: November 9, 2023; Revised: November 13, 2023; Accepted: November 14, 2023; Published online: January 1, 2024.
© The Korean Society of Applied Pharmacology. All rights reserved.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Non-alcoholic fatty liver disease (NAFLD) is characterized by excessive accumulation of fat in the liver, and there is a global increase in its incidence owing to changes in lifestyle and diet. Recent findings suggest that p53 is involved in the development of non-alcoholic fatty liver disease; however, the association between p53 expression and the disease remains unclear. Doxorubicin, an anticancer agent, increases the expression of p53. Therefore, this study aimed to investigate the role of doxorubicin-induced p53 upregulation in free fatty acid (FFA)-induced intracellular lipid accumulation. HepG2 cells were pretreated with 0.5 μg/mL of doxorubicin for 12 h, followed by treatment with FFA (0.5 mM) for 24 h to induce steatosis. Doxorubicin pretreatment upregulated p53 expression and downregulated the expression of endoplasmic reticulum stress- and lipid synthesis-associated genes in the FFA -treated HepG2 cells. Additionally, doxorubicin treatment upregulated the expression of AMP-activated protein kinase, a key modulator of lipid metabolism. Notably, siRNA-targeted p53 knockdown reversed the effects of doxorubicin in HepG2 cells. Moreover, doxorubicin treatment suppressed FFA -induced lipid accumulation in HepG2 spheroids. Conclusively, these results suggest that doxorubicin possesses potential application for the regulation of lipid metabolism by enhance the expression of p53 an in vitro NAFLD model.
Keywords: AMP-activated protein kinase, Doxorubicin, Fatty acid synthesis, Lipid metabolism, Non-alcoholic fatty liver disease, p53
INTRODUCTION

Non-alcoholic fatty liver disease (NAFLD) is a chronic disease characterized by excessive triglyceride (TG) accumulation in the liver and is not caused by alcohol consumption. NAFLD can progress to non-alcoholic steatohepatitis, advanced fibrosis/cirrhosis, and liver carcinoma (Huh et al., 2022; McGlinchey et al., 2022). Recently, there has been a global increase in liver-related mortality owing to the high prevalence of NAFLD (Estes et al., 2018). Although several studies have been conducted on NAFLD, the pathogenesis of the disease remains unclear, and there is currently no effective treatment.

The tumor suppressor gene p53 plays an important role in several signaling pathways, leading to cell cycle arrest and promotion of apoptosis and senescence (Kruse and Gu, 2009). Particularly, doxorubicin activates p53 by inducing nuclear accumulation of p53 from the cytosol (Yahagi et al., 2004; Jiang et al., 2013; Moulder et al., 2018). Therefore, it is generally used as an anticancer drug to treat solid tumors through reactive oxygen species (ROS) generation and DNA damage (Primeau et al., 2005; Kciuk et al., 2023). Considering that cancers with mutated p53 are resistant to doxorubicin, the upregulation of p53 activity is believed to be essential for the effects of doxorubicin.

Recent findings suggest that p53 acts as a metabolic regulator that contributes to tumor suppression (Vousden and Ryan, 2009; Liu and Gu, 2022). The effects of p53 on cellular metabolism involve the regulation of glycolysis, mitochondrial oxidative phosphorylation, and lipid metabolism. Notably, p53 inhibits lipid biosynthesis and promotes peroxisomal fatty acid beta-oxidation in cancer cells (Liu and Gu, 2022; Zhao et al., 2023). Although recent research suggests that p53 is involved in NAFLD, studies on the specific mechanism and role of p53 in the disease has yielded conflicting results. p53 protects against fatty liver by attenuating the expression of lipogenesis-related genes, such as fatty acid synthase (FAS) and sterol regulatory element-binding protein (SREBP)-1 (Yahagi et al., 2003; Goldstein et al., 2012). Additionally, p53 stimulates fatty acid oxidation, decreases inflammation and endoplasmic reticulum (ER) stress (Panasiuk et al., 2006; Namba et al., 2015), and ameliorates diet-induced non-alcoholic steatosis and steatohepatitis in mice (Porteiro et al., 2018). Moreover, the acute loss of p53 in the liver of adult mice impairs glycogen storage and induces steatosis (Prokesch et al., 2017). In contrast, other studies showed that reduced p53 expression attenuates NAFLD progression. Inhibiting the transcriptional activity of p53 by injecting a p53 inhibitor into mice fed high-fat diet attenuated hepatic steatosis-associated oxidative stress (Derdak et al., 2013). Moreover, p53 knockdown inhibited palmitate-induced lipid accumulation in cell models (Zhang et al., 2020). Furthermore, p53 activation induced hepatic abnormalities, such as steatosis and insulin resistance, which contributed to liver damage (Derdak et al., 2013). Overall, these contradictory findings indicate that the role of p53 in NAFLD is complex and may depend on multiple factors.

Therefore, this study aimed to investigate the therapeutic effects of doxorubicin-induced p53 activation in NAFLD. Specifically, we used a non-toxic dose of doxorubicin to exclude side effects such as cytotoxicity and assessed its effects in an in vitro NAFLD model. Additionally, we transfected doxorubicin-treated cells with p53 siRNA to clarify its role in intracellular lipid accumulation. Overall, it is anticipated that this study will improve our understanding of the role of the doxorubicin-p53 axis in NAFLD.

MATERIALS AND METHODS

Cell culture and treatment

Human liver HepG2 cells (ATCC, Manassas, VA, USA) were maintained in Dulbecco’s modified Eagle’s medium (Welgene, Kyungsan, Korea) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution (HyClone, Logan, UT, USA) at 37°C in a humidified atmosphere containing 5% CO2. HepG2 cells were pretreated with 0.1-0.5 μg/mL of doxorubicin (Sigma-Aldrich, St. Louis, MO, USA) for 12 h, followed by treatment with varying concentrations of free fatty acid (FFA) composed of BSA-conjugated oleic acid and palmitic acid (2:1) for 24 h.

Cell viability assay

Cell viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, cells were incubated in a medium containing 0.5 mg/mL of MTT for 1 h at 37°C, and the formed formazan granules were subsequently dissolved in DMSO. The absorbance of the final solution was measured at 540 nm using a Multiskan GO reader (Thermo Fisher Scientific, Waltham, MA, USA).

siRNA-mediated p53 knockdown

p53 siRNA oligonucleotides were obtained from IDT Tech (Niles, IL, USA), and their sequences are summarized in Table 1. Briefly, HepG2 cells were transfected with p53 siRNA oligonucleotides using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Specifically, the cells were incubated with p53 siRNA and Lipofectamine 3000 mixed in serum-free OptiMEM (Thermo Fisher Scientific) for 12 h. The medium was replaced with a complete medium containing doxorubicin and incubated for another 12 h. Finally, cells were treated with 0.5 mM of FFA and harvested 24 h later for analysis.

Table 1 List of human p53 siRNA oligonucleotides

Oligo Sequence

p53 siRNA oligo 1

p53 siRNA oligo 2

p53 siRNA oligo 3

AACCUCUUGGUGAACCUUAGGUACUAAGGUUCACCA

AGCAUCUUAUCCGAGUGGUUUCCUUCCACUCGGAUA

GAGGUUGGCUCUGACUGUGGUGGUACAGUCAGAG



RNA isolation and gene expression analysis

Briefly, cell lysis was performed using TRIzol™ (Ambion, Life Technologies, Waltham, MT, USA), followed by total RNA extraction using Direct-zol™ RNA MiniPrep (Zymo Research, Irvine, CA, USA). cDNA was synthesized from total RNA using iScript cDNA kit from Bio-Rad. cDNA amplification was performed on the Bio-Rad CFX Connect™ Real-Time PCR Detection System (Hercules, CA, USA) using SmartGene SYBR Green Q-PCR Master Mix (SamJung Bio Science, Daejeon, Korea) and specific primers. The PCR conditions were as follows: denaturation at 95°C for 5 min; 40 cycles at 95°C for 1 s, 60°C for 30 s, 72°C for 20 s to generate melting curves. Relative gene expression was analyzed using the Livak method (Livak and Schmittgen, 2001). A normalized expression ratio (2−ΔΔCt) was calculated for each target gene, representing the fold difference in mRNA expression in the treatment groups when compared with that in the control group. The primer sets used in this study are listed in Table 2.

Table 2 List of human primers used for real-time RT-PCR

SymbolPrimer sequence (5’-3’)
ForwardReverse
GRP78TCGGCCGCACGTGGAATGACGCAGCTGCCGTAGGCTCGTT
CHOPCAGAACCAGCAGAGGTCACAAGCTGTGCCACTTTCCTTTC
PPARαCAATGCACTGGAACTGGATGAGTTGCTCTGCAGGTGGAGTCT
p53AACAACACCAGCTCCTCTCCCTCATTCAGCTCTCGGAACA
GAPDHGGCGTCTTCACCACCATGGAGCCTGCTTCACCACCTTCTT


Protein expression analysis

HepG2 cell lysate was isolated using ice-cold ProEX™ CETi protein extract solution (TransLab Bioscience, Daejeon, Korea) containing a protease and phosphatase inhibitor cocktail. The protein concentration of cell lysate was measured using the BCA protein assay kit. Thereafter, equal amounts of protein were separated using sodium dodecyl sulphate‒polyacrylamide gels, transferred to membranes, and blocked with blocking buffer. The membranes were incubated with specific primary antibodies overnight at 4°C, washed with TBS-Tween 20 (TBST), and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. Signals were visualized using an enhanced EZ-Western Lumi Pico detection kit (Dogen Bio, Seoul, Korea) and Azure c300 western blot imaging system (Azure Biosystems, Dublin, CA, USA). The expression levels of the target proteins were normalized to that of α-tubulin. Antibodies against p-p53, acetyl-CoA-carboxylase 1 (ACC), p-ACC (Ser79), AMP-activated protein kinase (AMPK), p-AMPK (Thr172), FAS, and stearoyl-CoA desaturase 1 (SCD1) were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against activating transcription factor 6 (ATF6), peroxisome proliferator-activated receptor alpha (PPARα), cluster of differentiation 36 (CD36) were purchased from Abcam (Boston, MA, USA). Antibodies against p53, SREBP-1, and α-tubulin were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Determination of intracellular TG

Intracellular TG content was measured enzymatically using a TG assay kit (Asan Pharmaceutical, Seoul, Korea), according to the manufacturer’s instructions. TG concentration was measured at 540 nm using a MULTISKAN GO reader (Thermo Fisher Scientific).

Analysis intracellular lipid accumulation using Oil Red O and PC6S staining

To measure cellular lipid deposition, Oil Red O staining (Sigma-Aldrich) was performed as previously described (Kim et al., 2023). To quantify Oil Red O content, dimethyl sulfoxide (DMSO) was added to each sample. After 5 min, the sample density was measured at 510 nm using a MULTISKAN GO reader (Thermo Fisher Scientific). The difference in optical density was measured by normalization to total protein. To confirm lipid accumulation, cells were stained with π-extended fluorescent coumarin (PC6S; Tokyo Chemistry Inc, Tokyo, Japan) as previously described (Yoshihara et al., 2020). Briefly, cells were incubated with cell growth medium containing 100 nM of PC6S for 1 h and washed with PBS three times. After washing, signal intensity was measured using GloMax fluorescence reader (Promega, Madison, WI, USA). Images were obtained using an NiKon ECLPISE Ts2 microscope (Nikon, Tokyo, Japan).

Intracellular ROS assay

Intracellular oxidative stress was analyzed using the ROS-sensitive probe 2,7-dichlorodihydrofluoroscein diacetate (DCFDA, Invitrogen). To measure intracellular ROS, cells were incubated with 10 μM of DCFDA containing phenol-red free complete media for 2 h and fluorescence intensity was analyzed using GloMax fluorescence reader (Promega). The fluorescence value obtained was normalized to the total protein.

Determination of intracellular localization of p53 using immunofluorescence staining

Cells were seeded on a 4-well culture slide (Corning, Corning Glendale, AR, USA), fixed with 4% paraformaldehyde for 10 min, and incubated with 10% BSA in PBS for 1 h. Thereafter, the cells were incubated with anti-p53 antibody overnight at 4°C, followed by incubation with Cy3-conjugated goat anti-mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Fluorescence images were captured using a NiKon ECLPISE Ts2 microscope.

3D spheroids culture and analysis intracellular lipid accumulation using PC6S staining

HepG2 cells were cultured in PAMCELLTM R100 3D 96-well plate (ANK Corporation, Suwon, Korea) to generate 3D spheroids. After self-assembly into uniform spheroids, the cells were treated with doxorubicin and 0.1-1 mM of FFA for 24 h. Lipid accumulation was measured using PC6S staining, and the signal was analyzed using GloMax fluorescence reader (Promega). Fluorescence images were captured using a NiKon ECLPISE Ts2 microscope.

Statistical analysis

All data analyses were performed using GraphPad Prism (v5.0; GraphPad Software Inc.; La Jolla, CA, USA). Significant difference between groups was determined using t-test or one-way analysis of variance (ANOVA), followed by Newman-Keuls post-hoc test. Statistical significance was set at p<0.05.

RESULTS

Doxorubicin enhances nuclear p53 expression and suppresses FFA-induced intracellular lipid accumulation

The p53 protein family plays an important role in determining cell fate in response to stresses, including hypoxia, DNA damage, and oncogenic stress (Adamovich et al., 2014). However, doxorubicin can induce apoptosis by activating p53 and increasing ROS (Tsang et al., 2003). Therefore, we examined the effect of doxorubicin treatment (0.1-0.5 μg/mL) on the viability of HepG2 cells using MTT assay. Additionally, the expression of p53 was examined following doxorubicin treatment. Doxorubicin was not cytotoxic to HepG2 cells at concentrations ≤0.5 μg/mL; however, cell death was observed at concentrations >0.5 μg/mL (Fig. 1A). Importantly, doxorubicin treatment (0.2-0.5 μg/mL) caused a dose-dependent increase in the protein expression of p53 (data not shown here). Based on these results, we selected doxorubicin concentration of 0.5 μg/mL in subsequent experiments. Doxorubicin pretreatment increased the gene and protein expression of p53 and the protein expression of p-p53 in FFA-treated cells compared with that in the FFA only group (Fig. 1B, 1C). Additionally, we investigated the effect of doxorubicin pretreatment (0.5 μg/mL) on lipid accumulation in HepG2 cells. Doxorubicin treatment suppressed FFA-induced increased in intracellular TG levels (Fig. 1D) and decreased lipid accumulation in HepG2 cells compared with that in the FFA-only treated group (Fig. 1E).

Figure 1. Effect of doxorubicin on p53 expression and free fatty acid (FFA)-induced intracellular lipid accumulation in HepG2 cells. (A) Effect of doxorubicin on cell viability. For MTT assay, cells were treated with indicated concentration of doxorubicin for 48 h. (B) Doxorubicin caused a dose-dependent increase in p53 gene expression. (C) Doxorubicin enhanced the protein expression of p53. (D) Intracellular TG content. (E) Oil Red O staining was performed to assess lipid accumulation. TG analysis and Oil Red O intensity were quantified by total cell number and the data are presented from three independent experiments. (F) Intracellular localization of p53 and lipid accumulation in doxorubicin-treated cells. Nuclear staining was performed using DAPI (4’,6-diamidino-2-phenylindole). HepG2 cells were pretreated with 0.5 μg/mL of doxorubicin for 12 h, followed by incubation with 0.5 mM of FFA composed of BSA-conjugated oleic acid and palmitic acid (2:1) for 24 h. Data are presented as mean ± standard deviation (SD). ***p<0.001 (compared with CON, Student’s t-test). Different letters indicate significant differences (p<0.05) among the groups (one-way ANOVA followed by Newman-Keuls multiple comparison test). CON, control; Dox, doxorubicin.

Doxorubicin induces the accumulation of p53 in the nucleus and enhances total p53 expression (Yun et al., 2000). Therefore, immunofluorescence staining was performed to elucidate the effect of doxorubicin on the localization of p53 after FFA treatment. Although, FFA treatment deceased the expression of p53 in the nucleus, doxorubicin treatment increased the nuclear expression of p53 in HepG2 cells (Fig. 1F). Additionally, PC6S staining showed that FFA treatment increased intracellular lipid accumulation, which was significantly decreased by doxorubicin treatment. Collectively, these results indicate that doxorubicin enhances p53 expression and nuclear accumulation and suppresses FFA-induced lipid accumulation in HepG2 cells.

Doxorubicin decreases the expression of ER stress- and ROS-associated molecules in FFA-treated HepG2 cells

We investigated the effects of doxorubicin on ER stress in FFA-treated cells. Glucose regulatory protein (GRP78), also known as BiP, serves as an indicator of ER stress (Dauer et al., 2019; Ge and Kao, 2019). GRP78 play a key role in regulating the activation of intermembrane ER stress sensors, including the inositol-requiring enzyme (IRE1) and ATF6, a transcription factor activated by ER stress through a binding release mechanism (Carrara et al., 2015; Tsuru et al., 2016). The expression of C/EBP homologous protein (CHOP), a key initiating factor of ER stress-related cell death, was also evaluated. Doxorubicin suppressed FFA-induced expression of the ER stress-associated genes GRP78 and CHOP in HepG2 cells compared to the FFA-only group (Fig. 2A).

Figure 2. Doxorubicin reduces free fatty acid (FFA)-induced endoplasmic reticulum (ER) stress and reactive oxygen species (ROS) generation in HepG2 cells. (A) Gene expression of ER-stress associated factors were measured. (B) ROS signal was measured using DCFDA and quantified by total cell numbers. Cells were pretreated with doxorubicin for 12 h, followed by FFA treatment for 24 h. Data are presented mean ± standard deviation of values from three independent experiments. Different letters indicate significant differences (p<0.05) among the groups (one-way ANOVA followed by Newman-Keuls multiple comparison test). CON, control; Dox, doxorubicin.

Abnormal ROS generation in NAFLD leads to a disruption in redox homeostasis in hepatocytes (Ma et al., 2021). In light of research suggesting that doxorubicin can heighten intracellular levels of reactive oxygen species (ROS) and cause DNA damage in animal studies (Asensio-López et al., 2017; Cappetta et al., 2017), we investigated how cellular ROS levels were affected when doxorubicin was combined with FFA. Confirming previous observations (Tang et al., 2014; Wang and Kaufman, 2014), FFA treatment was found to increase ROS levels. Interestingly, this rise in ROS was counteracted when doxorubicin was administered alongside FFA (Fig. 2B). Overall, these results suggest that doxorubicin treatment suppresses FFA-induced ROS generation in HepG2 cells.

Doxorubicin regulates the expression of lipid synthesis- and export-associated molecules in FFA-treated cells

Lipid synthesis-associated molecules, such as SREBP-1, regulate intracellular lipid metabolism and a dysfunction can cause fat accumulation in non-adipose tissue such as the liver (Li et al., 2012). FAS catalyzes all the reaction steps in the conversion of acetyl-CoA and malonyl-CoA to palmitate (Jensen-Urstad and Semenkovich, 2012). SCD1 converts saturated fatty acids to monounsaturated fatty acids (Matsui et al., 2012). In the present study, doxorubicin treatment significantly suppressed FFA-induced increase in the expression of SREBP-1, FAS, and SCD1 (Fig. 3A). Overall, these results indicate that doxorubicin inhibits FFA-induced lipid synthesis in HepG2 cells.

Figure 3. Doxorubicin regulates the expression of lipid synthesis- and export-associated genes in free fatty acid (FFA)-treated cells. Protein expression of (A) lipid synthesis and (B) lipid export associated factors after doxorubicin and/or FFA treatment. Cells were pretreated with doxorubicin for 12 h, followed by FFA treatment for 24 h. Data from three independent experiments are expressed as mean ± standard deviation (SD). Different letters indicate significant differences (p<0.05) among the groups (one-way ANOVA followed by Newman-Keuls multiple comparison test). CON, control; Dox, doxorubicin.

To elucidate the effects of doxorubicin on lipid accumulation in NAFLD, we examined the expression of proteins related to fatty acid absorption and lipid export. Doxorubicin treatment significantly reversed FFA-induced decrease in the protein expression of PPARα (Fig. 3B), a promoter of glycolysis and de novo fatty acid synthesis (Pawlak et al., 2015). To evaluate the AMPK pathway, the expression of p-AMPK (Thr172) and p-ACC (Ser79) was investigated after FFA and doxorubicin co-treatment. Doxorubicin treatment significantly reversed FFA-induced decrease in the protein expression of p-AMPK and p-ACC compared with that in the FFA-only group.

Doxorubicin affects FFA-induced lipid accumulation via upregulation of p53 expression in HepG2 cells

Based on the results, we proposed that doxorubicin-induced upregulation of p53 expression may inhibit lipid synthesis. p53 regulates genes and enzymes involved in lipid synthesis by inhibiting the transcription of SREBP-1 (Chen and Wang, 2021). To verify this hypothesis, we examined whether doxorubicin-mediated inhibition of FFA-induced lipid accumulation and synthesis by FFA were directly related to the function of p53 and the lipid accumulation pathway. Specifically, we knockdown p53 expression using siRNA and examined the effect of doxorubicin treatment on the expression of proteins involved in lipid synthesis. Quantitative real-time PCR confirmed the successful knockdown of p53 (Fig. 4A). The knockdown of p53 significantly increased both the TG content (Fig. 4B) and lipid accumulation (Fig. 4C), regardless of doxorubicin treatment. Additionally, PC6S staining showed increased intracellular lipid accumulation following p53 knockdown (Fig. 4D). Collectively, these results indicate that the doxorubicin-induced decrease in lipid accumulation in HepG2 cells is depends on the expression of p53.

Figure 4. p53 knockdown rescues the inhibitory effect of doxorubicin on free fatty acid (FFA)-induced lipid accumulation in HepG2 cells. (A) Protein expression of p53. (B) Intracellular triglyceride (TG) content and (C) Oil Red O staining. (D) Immunofluorescence staining for p53 and lipid content (PC6S). Nuclear staining was performed using DAPI. Cells were pretreated with doxorubicin for 12 h to induce p53, followed by transfection with p53 siRNA oligonucleotides for 12 h using Lipofectamine 3000. The medium was replaced with a medium containing 0.5 mM of FFA. Data from three independent experiments are presented mean ± standard deviation (SD). ***p<0.001 (Student’s t-test). Dox, doxorubicin.

Doxorubicin affects protein and gene expression of lipid metabolism and ROS-associated molecules in HepG2 cells in a p53-dependent manner

Furthermore, we examined the effect of p53 knockdown on the expression of lipid synthesis-associated proteins in FFA-treated cells. p53 knockdown significantly increased the expression the ER stress-related gene CHOP and the lipid synthesis gene SREBP-1, but downregulated the expression of PPARα (Fig. 5A). Similarly, p53 knockdown upregulated the expression of ER stress-, lipid synthesis-, and lipid transport-associated proteins, including ATF6, CD36, SREBP-1, FAS, and SCD1, but downregulated the expression of PPARα, AMPK, p-AMPK (Thr172), ACC, and p-ACC (Ser79) (Fig. 5B). Additionally, p53 knockdown significantly increased ROS levels (Fig. 5C). Collectively, these results showed that doxorubicin-induced upregulation of p53 is closely involved in the regulation of the lipid metabolism pathway.

Figure 5. p53 knockdown reverses the effects of doxorubicin in free fatty acid (FFA)-treated HepG2 cells. (A) Gene expression of CHOP, SREBP-1, and PPARα. (B) Protein expression of endoplasmic reticulum (ER) stress (ATF6), lipid uptake (CD36), lipid synthesis (SREBP-1, FAS, SCD1), and AMPK-mediated lipid metabolism pathway (PPARα, AMPK, p-AMPK, ACC, p-ACC) in p53 knockdown cells after doxorubicin and FFA treatment. (C) Intracellular reactive oxygen species (ROS) level was assessed using DCFDA. ROS signal was quantified by total cell numbers. Cells were pretreated with doxorubicin for 12 h to induce p53, followed by transfection with p53 siRNA oligonucleotides for 12 h using Lipofectamine 3000. The medium was replaced with a medium containing 0.5 mM of FFA. Data from three independent experiments are expressed as mean ± standard deviation (SD). **,***p<0.01 and 0.001 (Student’s t-test). Dox, doxorubicin.

Doxorubicin decreases FFA-induced lipid accumulation in HepG2 3D spheroids

To closely mimic the complexities of the in vivo environment, we examined the inhibitory effects of doxorubicin on FFA-induced lipid accumulation in a three-dimensional (3D) culture of HepG2 spheroids. The PAMCELLTM R100 plate facilitated the formation of well-defined HepG2 cell spheroids, validating the efficacy of the 3D culture technique. Consistent with the result of 2D culture, doxorubicin treatment significantly suppressed FFA-induced increase in lipid accumulation in HepG2 (Fig. 6A, 6B).

Figure 6. Doxorubicin downregulates free fatty acid (FFA)-mediated lipid accumulation in HepG2 3D spheroids. Lipid accumulation increased in a (A) FFA dose-dependent manner, (B) which was suppressed by doxorubicin treatment. HepG2 cells were cultured in PAMCELLTM R100 3D 96-well plate until cell’s self-assembled spheroids formed. Cells were treated with doxorubicin for 12 h, followed by treatment with indicated concentrations of FFA. Lipid accumulation was assessed using PC6S. Relative intensity of each samples were measured using Image Studio software and each value represents the mean ± standard deviation (SD). ***p<0.001 (compared with 0 mM FFA, Student’s t-test). Different letters indicate significant differences (p<0.05) among the groups (one-way ANOVA followed by Newman-Keuls multiple comparison test). Dox, doxorubicin.
DISCUSSION

The influence of p53 on lipid metabolism and inflammation in NAFLD has been extensively studied (Panasiuk et al., 2006; Porteiro et al., 2018). Although p53 regulates genes involved in lipid metabolism, including fatty acid oxidation, lipid synthesis, and transport in cancer cells, its function in NAFLD remains unclear. In this study, we examined the role of the doxorubicin-p53 axis on lipid metabolism during the development of NAFLD. Doxorubicin enhanced p53 expression and nuclear accumulation (Fig. 1) and inhibited FFA treatment-induced lipid accumulation in 2D (Fig. 1, 3) and 3D spheroid systems (Fig. 6). Consistent with previous findings that p53 negatively regulates steatosis (Derdak et al., 2013), our results suggest that p53 may inhibit the development of NAFLD.

Various regulatory pathways are involved in the ER stress and lipid metabolism. ER dysfunction triggers an unfolded protein response, which activates the transcription factor SREBP-1 and promotes the expression of genes involved in lipid synthesis, including FAS and ACC (Bravo et al., 2013; Han and Kaufman, 2016; Almanza et al., 2019). In the present study, FFA treatment increased ER stress, which was inhibited by doxorubicin (Fig. 2, 3). However, p53 knockdown increased ER stress regardless of doxorubicin treatment (Fig. 5), suggesting that doxorubicin ameliorates ER stress in a p53-dependent manner. Qu et al. (2004) reported that among various intracellular stresses, ER stress inhibits the function of p53 by retaining p53 in the cytoplasm (Qu et al., 2004). In contrast, doxorubicin treatment increased the nuclear accumulation of p53 (Fig. 1) and suppressed ER stress (Fig. 2). Therefore, the functional expression of p53 plays an important role in regulating ER stress, and doxorubicin treatment is an effective strategy to upregulate p53 expression.

Excessive FFA synthesis induces ROS generation (Schönfeld and Wojtczak, 2008; Yang et al., 2020; Konar et al., 2023). Therefore, we examined the effect of doxorubicin-mediated p53 upregulation on FFA-induced ROS production. Notably, high-dose of doxorubicin can increase ROS generation and induces ROS-mediated senescence and lipid synthesis by overcoming the key function of p53 (Wen et al., 2023). Moreover, p53 knockdown-induced increase in ROS production suggests that non-toxic dose of doxorubicin might play an anti-oxidative role via p53 activation.

SREBP-1 is a lipogenic transcription factor that activates genes involved in lipid synthesis (Li et al., 2011), including ACC, FAS, and SCD1. FAS catalyzes all reaction steps in the conversion of acetyl-CoA and malonyl-CoA to palmitate (Jensen-Urstad and Semenkovich, 2012). SCD1 facilitates lipid accumulation by converting saturated fatty acids to monounsaturated fatty acids (Flowers and Ntambi, 2008). Doxorubicin-induced suppression of ER and oxidative stress downregulated the expression of genes regulated by SREBP-1. Moreover, p53 binds to a CpG island located in the human SCD1 locus (Krstic et al., 2018) and suppresses SCD1 (Lacroix et al., 2021). In the present study, doxorubicin-induced downregulation of SREBP-1 and SCD1 was p53-dependent (Fig. 3, 5).

AMPK, a serine/threonine kinase, plays an important role in maintaining the overall energy balance in the body. AMPK activation via Thr172 phosphorylation regulates genes involved in fatty acid oxidation and energy metabolism under low intracellular energy conditions (Sozio et al., 2011; Herzig and Shaw, 2018). AMPK activation regulates lipid metabolism by inducing ACC phosphorylation at Ser79 (Winder and Hardie, 1996). This phosphorylation event inhibits the production of malonyl-CoA, which is a crucial substrate for FAS, ultimately leading to the suppression of the de novo synthesis of palmitate (Galic et al., 2018). Additionally, AMPK stimulates SREBP-1 phosphorylation at Ser372 and suppresses its cleavage and nuclear translocation, resulting in the suppression of its transcription. Therefore, AMPK activation prevents its own activation and that of its target genes (ACC, FAS, and SCD1) (Li et al., 2011). In the present study, doxorubicin suppressed FFA-induced expression of lipogenesis-related proteins, including SREBP-1, FAS, and SCD1, but upregulated PPARα expression and AMPK and ACC phosphorylation at Thr172 and Ser79, respectively. Notably, p53 knockdown reversed the effects of doxorubicin (Fig. 5). Overall, these results suggest that AMPK activation is a pivotal event in doxorubicin-induced regulation of lipid metabolism.

Notably, it is important to acknowledge that the beneficial effects of doxorubicin in steatosis maybe debatable, especially the role of p53. Contrary to our findings, p53 knockdown ameliorated NAFLD in mice fed high-fat diet and in cell models (Zhang et al., 2020). Additionally, p53 inhibition alleviated liver lipotoxicity in mice fed high-fat diet by promoting the beta-oxidation of fatty acids (Derdak et al., 2013). Further studies are necessary to elucidate the reasons for the conflicting results. However, it is plausible that doxorubicin-induced p53 expression regulated lipid accumulation through alternative mechanisms, such as alterations in lipid synthesis-related signaling pathways.

Consistent with our findings, low-dose of doxorubicin upregulated p53 expression, which enhanced fatty acid oxidation and reduced fat production (Porteiro et al., 2018). Similarly, doxorubicin inhibited lipid accumulation, and this effect was attenuated by p53 knockdown (Fig. 5). Notably, we also validated the effects of doxorubicin on lipid accumulation in 3D cell cultures to mimic in vivo conditions (Fig. 6). Collectively, these results indicate that a close connection between the functions of doxorubicin and p53 in the progression of NAFLD. Although the specific role of doxorubicin in the development of NAFLD remains unclear, this study provides a theoretical basis for application of p53 in NAFLD treatment. Therefore, future studies should focus on elucidating the precise mechanisms of doxorubicin the treatment of NAFLD.

Conclusively, doxorubicin inhibits lipid synthesis by downregulating the expression of genes and proteins involved in lipid synthesis. Additionally, doxorubicin suppresses TG and ROS production in FFA-treated HepG2 cells, suggesting that doxorubicin possesses potential application for the treatment of NAFLD. However, further studies on the safety, efficacy, and optimal dose of doxorubicin are necessary to facilitate its application in NAFLD treatment. Moreover, the underlying molecular mechanisms and pathways of doxorubicin, especially p53 expression, in the progression of NAFLD should be extensively studied.

ACKNOWLEDGMENTS

This work was supported by the National Research Foundation of Korea (NRF) funded by the Korea government (MSIT) (NRF-2019R1I1A3A01058584) and the Commercializations Promotion Agency for R&D Outcomes (COMPA) grant funded by the Korea government (MSIT) (No. 2021N400).

References
  1. Adamovich, Y., Adler, J., Meltser, V., Reuven, N. and Shaul, Y. (2014) AMPK couples p73 with p53 in cell fate decision. Cell Death Differ. 21, 1451-1459.
    Pubmed KoreaMed CrossRef
  2. Almanza, A., Carlesso, A., Chintha, C., Creedican, S., Doultsinos, D., Leuzzi, B., Luís, A., McCarthy, N., Montibeller, L., More, S., Papaioannou, A., Püschel, F., Sassano, M. L., Skoko, J., Agostinis, P., de Belleroche, J., Eriksson, L. A., Fulda, S., Gorman, A. M., Healy, S., Kozlov, A., Muñoz-Pinedo, C., Rehm, M., Chevet, E. and Samali, A. (2019) Endoplasmic reticulum stress signalling - from basic mechanisms to clinical applications. FEBS J. 286, 241-278.
    Pubmed KoreaMed CrossRef
  3. Asensio-López, M. C., Soler, F., Pascual-Figal, D., Fernández-Belda, F. and Lax, A. (2017) Doxorubicin-induced oxidative stress: the protective effect of nicorandil on HL-1 cardiomyocytes. PLoS One 12, e0172803.
    Pubmed KoreaMed CrossRef
  4. Bravo, R., Parra, V., Gatica, D., Rodriguez, A. E., Torrealba, N., Paredes, F., Wang, Z. V., Zorzano, A., Hill, J. A., Jaimovich, E., Quest, A. F. and Lavandero, S. (2013) Endoplasmic reticulum and the unfolded protein response: dynamics and metabolic integration. Int. Rev. Cell Mol. Biol. 301, 215-290.
    Pubmed KoreaMed CrossRef
  5. Cappetta, D., De Angelis, A., Sapio, L., Prezioso, L., Illiano, M., Quaini, F., Rossi, F., Berrino, L., Naviglio, S. and Urbanek, K. (2017) Oxidative stress and cellular response to doxorubicin: a common factor in the complex milieu of anthracycline cardiotoxicity. Oxid. Med. Cell. Longev. 2017, 1521020.
    Pubmed KoreaMed CrossRef
  6. Carrara, M., Prischi, F., Nowak, P. R., Kopp, M. C. and Ali, M. M. (2015) Noncanonical binding of BiP ATPase domain to Ire1 and Perk is dissociated by unfolded protein CH1 to initiate ER stress signaling. Elife 4, e03522.
    Pubmed KoreaMed CrossRef
  7. Chen, L. L. and Wang, W. J. (2021) p53 regulates lipid metabolism in cancer. Int. J. Biol. Macromol. 192, 45-54.
    Pubmed CrossRef
  8. Dauer, P., Sharma, N. S., Gupta, V. K., Durden, B., Hadad, R., Banerjee, S., Dudeja, V., Saluja, A. and Banerjee, S. (2019) ER stress sensor, glucose regulatory protein 78 (GRP78) regulates redox status in pancreatic cancer thereby maintaining "stemness". Cell Death Dis. 10, 132.
    Pubmed KoreaMed CrossRef
  9. Derdak, Z., Villegas, K. A., Harb, R., Wu, A. M., Sousa, A. and Wands, J. R. (2013) Inhibition of p53 attenuates steatosis and liver injury in a mouse model of non-alcoholic fatty liver disease. J. Hepatol. 58, 785-791.
    Pubmed KoreaMed CrossRef
  10. Estes, C., Razavi, H., Loomba, R., Younossi, Z. and Sanyal, A. J. (2018) Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology 67, 123-133.
    Pubmed KoreaMed CrossRef
  11. Flowers, M. T. and Ntambi, J. M. (2008) Role of stearoyl-coenzyme A desaturase in regulating lipid metabolism. Curr. Opin. Lipidol. 19, 248-256.
    Pubmed KoreaMed CrossRef
  12. Galic, S., Loh, K., Murray-Segal, L., Steinberg, G. R., Andrews, Z. B. and Kemp, B. E. (2018) AMPK signaling to acetyl-CoA carboxylase is required for fasting- and cold-induced appetite but not thermogenesis. Elife 7, e32656.
    CrossRef
  13. Ge, R. and Kao, C. (2019) Cell surface GRP78 as a death receptor and an anticancer drug target. Cancers (Basel) 11, 1787.
    Pubmed KoreaMed CrossRef
  14. Goldstein, I., Ezra, O., Rivlin, N., Molchadsky, A., Madar, S., Goldfinger, N. and Rotter, V. (2012) p53, a novel regulator of lipid metabolism pathways. J. Hepatol. 56, 656-662.
    Pubmed CrossRef
  15. Han, J. and Kaufman, R. J. (2016) The role of ER stress in lipid metabolism and lipotoxicity. J. Lipid Res. 57, 1329-1338.
    Pubmed KoreaMed CrossRef
  16. Herzig, S. and Shaw, R. J. (2018) AMPK: guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 19, 121-135.
    Pubmed KoreaMed CrossRef
  17. Huh, Y., Cho, Y. J. and Nam, G. E. (2022) Recent epidemiology and risk factors of nonalcoholic fatty liver disease. J. Obes. Metab. Syndr. 31, 17-27.
    Pubmed KoreaMed CrossRef
  18. Jensen-Urstad, A. P. and Semenkovich, C. F. (2012) Fatty acid synthase and liver triglyceride metabolism: housekeeper or messenger?. Biochim. Biophys. Acta 1821, 747-753.
    Pubmed KoreaMed CrossRef
  19. Jiang, P., Du, W. and Yang, X. (2013) p53 and regulation of tumor metabolism. J. Carcinog. 12, 21.
    Pubmed KoreaMed CrossRef
  20. Kciuk, M., Gielecińska, A., Mujwar, S., Kołat, D., Kałuzińska-Kołat, Ż., Celik, I. and Kontek, R. (2023) Doxorubicin-an agent with multiple mechanisms of anticancer activity. Cells 12, 659.
    Pubmed KoreaMed CrossRef
  21. Kim, S. H., Yun, C., Kwon, D., Lee, Y. H., Kwak, J. H. and Jung, Y. S. (2023) Effect of isoquercitrin on free fatty acid-induced lipid accumulation in HepG2 cells. Molecules 28, 1476.
    Pubmed KoreaMed CrossRef
  22. Konar, S., Hedges, C. P., Callon, K. E., Bolam, S., Leung, S., Cornish, J., Naot, D. and Musson, D. S. (2023) Palmitic acid reduces viability and increases production of reactive oxygen species and respiration in rat tendon-derived cells. bioRxiv doi: 10.1101/2023.02.08.527761 [Preprint].
    CrossRef
  23. Krstic, J., Galhuber, M., Schulz, T. J., Schupp, M. and Prokesch, A. (2018) p53 as a dichotomous regulator of liver disease: the dose makes the medicine. Int. J. Mol. Sci. 19, 921.
    Pubmed KoreaMed CrossRef
  24. Kruse, J. P. and Gu, W. (2009) Modes of p53 regulation. Cell 137, 609-622.
    Pubmed KoreaMed CrossRef
  25. Lacroix, M., Linares, L. K., Rueda-Rincon, N., Bloch, K., Di Michele, M., De Blasio, C., Fau, C., Gayte, L., Blanchet, E., Mairal, A., Derua, R., Cardona, F., Beuzelin, D., Annicotte, J. S., Pirot, N., Torro, A., Tinahones, F. J., Bernex, F., Bertrand-Michel, J., Langin, D., Fajas, L., Swinnen, J. and Le Cam, L. (2021) The multifunctional protein E4F1 links P53 to lipid metabolism in adipocytes. Nat. Commun. 12, 7037.
    Pubmed KoreaMed CrossRef
  26. Li, Y., Xu, S., Mihaylova, M. M., Zheng, B., Hou, X., Jiang, B., Park, O., Luo, Z., Lefai, E., Shyy, J. Y., Gao, B., Wierzbicki, M., Verbeuren, T. J., Shaw, R. J., Cohen, R. A. and Zang, M. (2011) AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 13, 376-388.
    Pubmed KoreaMed CrossRef
  27. Li, Y., Zhang, Y., Li, R., Chen, W., Howell, M., Zhang, R. and Chen, G. (2012) The hepatic Raldh1 expression is elevated in Zucker fatty rats and its over-expression introduced the retinal-induced Srebp-1c expression in INS-1 cells. PLoS One 7, e45210.
    Pubmed KoreaMed CrossRef
  28. Liu, Y. and Gu, W. (2022) The complexity of p53-mediated metabolic regulation in tumor suppression. Semin. Cancer Biol. 85, 4-32.
    Pubmed KoreaMed CrossRef
  29. Livak, K. J. and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
    Pubmed CrossRef
  30. Ma, Y., Lee, G., Heo, S. Y. and Roh, Y. S. (2021) Oxidative stress is a key modulator in the development of nonalcoholic fatty liver disease. Antioxidants (Basel) 11, 91.
    Pubmed KoreaMed CrossRef
  31. Matsui, H., Yokoyama, T., Sekiguchi, K., Iijima, D., Sunaga, H., Maniwa, M., Ueno, M., Iso, T., Arai, M. and Kurabayashi, M. (2012) Stearoyl-CoA desaturase-1 (SCD1) augments saturated fatty acid-induced lipid accumulation and inhibits apoptosis in cardiac myocytes. PLoS One 7, e33283.
    Pubmed KoreaMed CrossRef
  32. McGlinchey, A. J., Govaere, O., Geng, D., Ratziu, V., Allison, M., Bousier, J., Petta, S., de Oliviera, C., Bugianesi, E., Schattenberg, J. M., Daly, A. K., Hyötyläinen, T., Anstee, Q. M. and Orešič, M. (2022) Metabolic signatures across the full spectrum of non-alcoholic fatty liver disease. JHEP Rep. 4, 100477.
    Pubmed KoreaMed CrossRef
  33. Moulder, D. E., Hatoum, D., Tay, E., Lin, Y. and McGowan, E. M. (2018) The roles of p53 in mitochondrial dynamics and cancer metabolism: the pendulum between survival and death in breast cancer?. Cancers (Basel) 10, 189.
    Pubmed KoreaMed CrossRef
  34. Namba, T., Chu, K., Kodama, R., Byun, S., Yoon, K. W., Hiraki, M., Mandinova, A. and Lee, S. W. (2015) Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway. Oncotarget 6, 19990-20001.
    Pubmed KoreaMed CrossRef
  35. Panasiuk, A., Dzieciol, J., Panasiuk, B. and Prokopowicz, D. (2006) Expression of p53, Bax and Bcl-2 proteins in hepatocytes in non-alcoholic fatty liver disease. World J. Gastroenterol. 12, 6198-6202.
    Pubmed KoreaMed CrossRef
  36. Pawlak, M., Lefebvre, P. and Staels, B. (2015) Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 62, 720-733.
    Pubmed CrossRef
  37. Porteiro, B., Fondevila, M. F., Buque, X., Gonzalez-Rellan, M. J., Fernandez, U., Mora, A., Beiroa, D., Senra, A., Gallego, R., Fernø, J., López, M., Sabio, G., Dieguez, C., Aspichueta, P. and Nogueiras, R. (2018) Pharmacological stimulation of p53 with low-dose doxorubicin ameliorates diet-induced nonalcoholic steatosis and steatohepatitis. Mol. Metab. 8, 132-143.
    Pubmed KoreaMed CrossRef
  38. Primeau, A. J., Rendon, A., Hedley, D., Lilge, L. and Tannock, I. F. (2005) The distribution of the anticancer drug Doxorubicin in relation to blood vessels in solid tumors. Clin. Cancer Res. 11, 8782-8788.
    Pubmed CrossRef
  39. Prokesch, A., Graef, F. A., Madl, T., Kahlhofer, J., Heidenreich, S., Schumann, A., Moyschewitz, E., Pristoynik, P., Blaschitz, A., Knauer, M., Muenzner, M., Bogner-Strauss, J. G., Dohr, G., Schulz, T. J. and Schupp, M. (2017) Liver p53 is stabilized upon starvation and required for amino acid catabolism and gluconeogenesis. FASEB J. 31, 732-742.
    Pubmed KoreaMed CrossRef
  40. Qu, L., Huang, S., Baltzis, D., Rivas-Estilla, A. M., Pluquet, O., Hatzoglou, M., Koumenis, C., Taya, Y., Yoshimura, A. and Koromilas, A. E. (2004) Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3beta. Genes Dev. 18, 261-277.
    Pubmed CrossRef
  41. Schönfeld, P. and Wojtczak, L. (2008) Fatty acids as modulators of the cellular production of reactive oxygen species. Free Radic. Biol. Med. 45, 231-241.
    Pubmed CrossRef
  42. Sozio, M. S., Lu, C., Zeng, Y., Liangpunsakul, S. and Crabb, D. W. (2011) Activated AMPK inhibits PPAR-{alpha} and PPAR-{gamma} transcriptional activity in hepatoma cells. Am. J. Physiol. Gastrointest. Liver Physiol. 301, G739-G747.
    Pubmed KoreaMed CrossRef
  43. Tang, C. H., Ranatunga, S., Kriss, C. L., Cubitt, C. L., Tao, J., Pinilla-Ibarz, J. A., Del Valle, J. R. and Hu, C. C. (2014) Inhibition of ER stress-associated IRE-1/XBP-1 pathway reduces leukemic cell survival. J. Clin. Invest. 124, 2585-2598.
    Pubmed KoreaMed CrossRef
  44. Tsang, W. P., Chau, S. P., Kong, S. K., Fung, K. P. and Kwok, T. T. (2003) Reactive oxygen species mediate doxorubicin induced p53-independent apoptosis. Life Sci. 73, 2047-2058.
    Pubmed CrossRef
  45. Tsuru, A., Imai, Y., Saito, M. and Kohno, K. (2016) Novel mechanism of enhancing IRE1α-XBP1 signalling via the PERK-ATF4 pathway. Sci. Rep. 6, 24217.
    Pubmed KoreaMed CrossRef
  46. Vousden, K. H. and Ryan, K. M. (2009) p53 and metabolism. Nat. Rev. Cancer 9, 691-700.
    Pubmed CrossRef
  47. Wang, M. and Kaufman, R. J. (2014) The impact of the endoplasmic reticulum protein-folding environment on cancer development. Nat. Rev. Cancer 14, 581-597.
    Pubmed CrossRef
  48. Wen, S. Y., Ali, A., Huang, I. C., Liu, J. S., Chen, P. Y., Padma Viswanadha, V., Huang, C. Y. and Kuo, W. W. (2023) Doxorubicin induced ROS-dependent HIF1α activation mediates blockage of IGF1R survival signaling by IGFBP3 promotes cardiac apoptosis. Aging (Albany N.Y.) 15, 164-178.
    Pubmed KoreaMed CrossRef
  49. Winder, W. W. and Hardie, D. G. (1996) Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am. J. Physiol. 270, E299-E304.
    Pubmed CrossRef
  50. Yahagi, N., Shimano, H., Matsuzaka, T., Najima, Y., Sekiya, M., Nakagawa, Y., Ide, T., Tomita, S., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Gotoda, T., Nagai, R., Kimura, S., Ishibashi, S., Osuga, J. and Yamada, N. (2003) p53 Activation in adipocytes of obese mice. J. Biol. Chem. 278, 25395-25400.
    Pubmed CrossRef
  51. Yahagi, N., Shimano, H., Matsuzaka, T., Sekiya, M., Najima, Y., Okazaki, S., Okazaki, H., Tamura, Y., Iizuka, Y., Inoue, N., Nakagawa, Y., Takeuchi, Y., Ohashi, K., Harada, K., Gotoda, T., Nagai, R., Kadowaki, T., Ishibashi, S., Osuga, J. I. and Yamada, N. (2004) p53 involvement in the pathogenesis of fatty liver disease. J. Biol. Chem. 279, 20571-20575.
    Pubmed CrossRef
  52. Yang, W., Zhao, J., Zhao, Y., Li, W., Zhao, L., Ren, Y., Ou, R. and Xu, Y. (2020) Hsa_circ_0048179 attenuates free fatty acid-induced steatosis via hsa_circ_0048179/miR-188-3p/GPX4 signaling. Aging (Albany N.Y.) 12, 23996-24008.
    Pubmed KoreaMed CrossRef
  53. Yoshihara, T., Maruyama, R., Shiozaki, S., Yamamoto, K., Kato, S. I., Nakamura, Y. and Tobita, S. (2020) Visualization of lipid droplets in living cells and fatty livers of mice based on the fluorescence of π-extended coumarin using fluorescence lifetime imaging microscopy. Anal. Chem. 92, 4996-5003.
    Pubmed CrossRef
  54. Yun, C., Lee, J. H., Park, H., Jin, Y. M., Park, S., Park, K. and Cho, H. (2000) Chemotherapeutic drug, adriamycin, restores the function of p53 protein in hepatitis B virus X (HBx) protein-expressing liver cells. Oncogene 19, 5163-5172.
    Pubmed CrossRef
  55. Zhang, X., Lin, Y., Lin, S., Li, C., Gao, J., Feng, Z., Wang, J., Zhang, J., Zhang, H., Zhang, Y., Chen, X., Chen, S., Xu, C., Li, Y., Yu, C. and Zeng, H. (2020) Silencing of functional p53 attenuates NAFLD by promoting HMGB1-related autophagy induction. Hepatol. Int. 14, 828-841.
    Pubmed KoreaMed CrossRef
  56. Zhao, J., Zhou, X., Chen, B., Lu, M., Wang, G., Elumalai, N., Tian, C., Zhang, J., Liu, Y., Chen, Z., Zhou, X., Wu, M., Li, M., Prochownik, E. V., Tavassoli, A., Jiang, C. and Li, Y. (2023) p53 promotes peroxisomal fatty acid β-oxidation to repress purine biosynthesis and mediate tumor suppression. Cell Death Dis. 14, 87.
    Pubmed KoreaMed CrossRef


This Article


Cited By Articles
  • CrossRef (0)

Funding Information

Services
Social Network Service

e-submission

Archives