Cardiovascular diseases (CVDs) are one of the leading causes of death worldwide, and various CVDs have been reported, including atherosclerosis (Sun et al., 2019). Atherosclerosis is a progressive disease that results from the accumulation of arterial damage, and it is influenced by cardiovascular risk factors, including age (Wang and Bennett, 2012). Human aging is characterized by gradual degeneration, structural and dysfunctional changes of organs, tissues, and cells (Poulose and Raju, 2014). Vascular aging is accompanied by dysfunctional vascular phenotypes, containing atherosclerosis and endothelial dysfunction. This plays a major role in most CVDs (Nikolajevic et al., 2022).

Cellular senescence, a hallmark aging mechanism, is defined as an arrest of endothelial cell proliferation and it is irreversible. This plays a crucial role in vascular aging (Jia et al., 2019; Kaur and Farr, 2020). Senescent endothelial cells exhibit impaired homeostatic functions, containing cell migration, angiogenesis, proliferation, nitric oxide (NO) production, and vascular inflammation (Jia et al., 2019). Senescent cells can propagate their senescent phenotype to healthy neighboring cells by releasing reactive oxygen species (ROS) and inflammatory mediators, including interleukin (IL)-6, IL-1β, and chemokine CCL2 (Nikolajevic et al., 2022). Recent research also shows that senescent endothelial cells secrete increased amounts of IL-17A, which can promote endothelial cell senescence by regulating the expression of cellular senescence marker proteins such as p16, p21 and p53, through NF-κB pathway (Zhang et al., 2021).

Here, we focused on the role of rhHAPLN1 in inhibiting endothelial senescence. In our previous study, we discovered a previously unrecognized function of HAPLN1 (Fu et al., Hyaluronan and proteoglycan link 1- a novel signaling molecule for rejuvenating aged skin) through parabiosis-based experiments, in which one young and one old animal shared a common bloodstream (Scudellari, 2015), and then an aptamer-based proteomic analysis was performed. These results showed that serum levels of HAPLN1 decreased with age, thereby disrupting the extracellular matrix (ECM) integrity of the aged skin that is predominantly composed of collagen I and hyaluronan (HA). In fact, HAPLN1 has been long known in proteoglycan components isolated from human articular cartilage proteoglycan aggregates (Roughley et al., 1982). ECM components include HAPLN1, which stabilizes major ECM proteins, HA and PGs (Wang et al., 2021). Recently, HAPLN1 gene expression has been shown to be reduced in aged fibroblasts and its reconstitution inhibits metastasis in the aged microenvironment (Kaur et al., 2019). HAPLN1 has also been known to play an important role in maintaining endothelial permeability, and its reduction in the aged microenvironment facilitates metastasis via blood vessels (Ecker et al., 2019). Other studies have provided evidence that the ‘‘link’’ function of HAPLN1 is crucial for stabilizing ECM components and regulating cell proliferation (Govindan and Iovine, 2014). However, an effect of HAPLN1 on age-related functions of vascular endothelium remains unknown. Here, we investigated a role of rhHAPLN1 in vascular endothelial senescence on the basis of cellular functions, such as cell proliferation, migration, and angiogenesis through its modulation of the SIRT1 levels. Our present data show that rhHAPLN1 has an important role in preventing vascular senescence in HUVECs, and represents a new therapeutic approach for the treatment of CVDs and atherosclerosis.

Cell culture

HUVECs were obtained from PromoCell (C-12203, Heidelberg, Germany). The cells were cultured in endothelial cell growth medium 2 (C-22111, PromoCell) supplemented with a Growth Medium 2 Supplement Pack (PromoCell) and incubated at 37°C in a 5% CO₂. Cells within passages 4-8 were considered young HUVECs, whereas cells within passages 18-21 were considered senescent HUVECs.

Western blotting

Western blot analysis was performed to detect pathway proteins in HUVECs, such as p53 (which is acetylated at K382 (Ac-p53), p16^INK4a, p21^CIP1, Cyclin E, CDK2, HAPLN1, IL-17A, SIRT1, eNOS, and p-eNOS (Ser-1177)). Briefly, total protein was extracted from the cells of each group using radioimmunoprecipitation assay (RIPA) buffer (BioWorld, Dublin, OH, USA) supplemented with protease and phosphatase inhibitors. Protein concentrations were determined using a BCA protein assay (Thermo Fisher Scientific, Waltham, MA, USA). Equivalent amounts of protein (15 μg) were electrophoresed on 8%-12% SDS-PAGE gels and transferred onto PVDF membranes (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% skim milk or 5% bovine serum albumin for 1 h and incubated overnight at 4°C with the primary antibodies against the following proteins: IL-17A, SIRT1 were purchased from Abcam (Cambridge, UK). Ac-p53, eNOS, p-eNOS were purchased from Cell Signaling Technology (Denver, CO, USA). p16^INK4a, p21^CIP1, GAPDH, CDK2, Cyclin E were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Also, anti-HAPLN1 was purchased from R&D Systems (Minneapolis, MN, USA). The membranes were incubated with anti-goat (R&D Systems) or anti-rabbit or anti-mouse (Cell Signaling) secondary antibodies for 1 h at room temperature after washing three times in TBST (TBS, 0.1% Tween-20). The protein bands were visualized using ECL reagent (GenDEPOT, Katy, TX, USA). For quantitative analysis, bands were analyzed by scanning densitometry using the ImageJ (NIH, Bethesda, MD, USA). The experiment was repeated three times.

Senescence-associated β-galactosidase (SA-β-gal) assay

To measure SA-β-gal activity, HUVECs were seeded in 12-well plates. Young HUVECs were treated with 5 ng/mL IL-17A (317-ILB, R&D Systems) and/or 2.5 ng/mL rhHAPLN1 (WUXI, Shanghai, China) for 24 h. Senescent HUVECs were treated with 2.5 ng/mL rhHAPLN1. After removing the medium, the cells were stained using the Senescence Cells Histochemical Staining Kit (CS0030, Sigma-Aldrich, St Louis, MO, USA) to detect the SA-β-gal activity in senescent cells, according to the manufacturer’s protocol. After staining, images were captured using an inverted microscope (Eclipse Ts2, Nikon, Tokyo, Japan).

Cellular ROS assay

To determine the cellular ROS levels, young HUVECs were treated with 2.5 ng/mL rhHAPLN1 for 24 h and then treated with 300 μM H₂O₂ (Sigma-Aldrich) for 30 min. Senescent HUVECs were treated with 2.5 ng/ml rhHAPLN1 for 24 h. Cells are washed with PBS and treated with 2 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Eugene, OR, USA) in cell growth medium for 30 min at 37°C. The cells were then detached using Trypsin/EDTA solution (TE, PromoCell) and washed three times with PBS. ROS levels were determined by fluorescence-activated cell sorting (FACS, BD Biosciences, San Jose, CA, USA) and the ROS levels was analyzed with FlowJo v10.8 software (BD Biosciences).

Wound healing assay

HUVECs were seeded in 6-well plates. After 48 h (when cells are approximately 100% confluence), a linear gap in the cell monolayer was created by scratching the surface using an SPLScar Scratcher (SPL Life Science, Pocheon, Korea). Young HUVECs were washed to remove the detached cells and treated with 5 ng/mL IL-17A and 2.5 ng/mL rhHAPLN1 for 8 h, while senescent HUVECs were washed to remove detached cells and treated with 2.5 ng/mL rhHAPLN1 for 8 h. Wound images were captured using an inverted microscope (Eclipse Ts2, Nikon) at 0 and 8 h, after which the wound area was determined using ImageJ software (NIH).

Tube formation assay

A 24-well plate was precooled at 4°C for 3 h and filled with Geltrex™ LDEV-free reduced growth factor basement membrane matrix (Thermo Fisher Scientific). Then, HUVECs were seeded in 24-well plates coated with solidified Geltrex™ basement membrane matrix and incubated for 24 h. ImageJ software (NIH) was then used to measure the number of meshes, branching intervals and total tube length on the captured images by inverted microscopy (Eclipse Ts2, Nikon).

Transfection of siRNA

Briefly, jetPRIME^® transfection reagent (Polyplus, Illkirch, France) was used to transfect siRNAs (100 pmol/mL) targeting human HAPLN1 to HUVECs according to the manufacturer’s instructions. Human HAPLN1 siRNA (NM_001884.3) and AccuTarget™ Negative Control siRNA were purchased from Bioneer (Daejeon, Korea). For the knockdown of HAPLN1, the cells were first incubated with control siRNA or HAPLN1 siRNA for 24 h, followed by incubation with incubator for 24 h in new growth medium.

Total RNA isolation and qRT-PCR

Total RNA was extracted from the cultured cells using a RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and its concentration and purity were determined by spectrophotometry. RNA was reverse-transcribed using the PrimeScript RT reagent kit (TaKaRa Bio, Shiga, Japan) according to the manufacturer’s instructions. qRT-PCR was performed using the Bio-Rad SYBR Green reagent and Bio-Rad CFX-Connect. All primer sequences are listed in Table 1. The data were analyzed using the ΔΔCt method, and GAPDH was used as an internal control. All qRT-PCR reactions were independently repeated three times.

Table 1 Primers used in this study

Name	Primer	Sequence (5’-3’)
p53	Forward primer	ACAGCTTTGAGGTGCGTGTTT
	Reverse primer	CCCTTTCTTGCGGAGATTCTCT
p21CIP1	Forward primer	TGTCCGTCAGAACCCATGC
	Reverse primer	AAAGTCGAAGTTCCATCGCTC
p16INK4a	Forward primer	GATCCAGGTGGGTAGAAGGTC
	Reverse primer	CCCCTGCAAACTTCGTCCT
IL-6	Forward primer	TGGCTGCAGGACATGACAA
	Reverse primer	TGAGGTGCCCATGCTACATTT
IL-17A	Forward primer	TCCCACGAAATCCAGGATGC
	Reverse primer	GGATGTTCAGGTTGACCATCAC
IL-1β	Forward primer	TTCGACACATGGGATAACGAGG
	Reverse primer	TTTTTGCTGTGAGTCCCGGAG
CCL2	Forward primer	AGAATCACCAGCAGCAAGTGTCC
	Reverse primer	TCCTGAACCCACTTCTGCTTGG
HAPLN1	Forward primer	TCTGGTGCTGATTTCAATCTGC
	Reverse primer	TGCTTGGATGTGAATAGCTCTG
GAPDH	Forward primer	GTGAAGGTCGGAGTCAACG
	Reverse primer	TGAGGTCAATGAAGGGGTC
SIRT1	Forward primer	GCAGATTAGTAGGCGGCTTG
	Reverse primer	TCTGGCATGTCCCACTATCA

Cell cycle analysis

Cell cycle analysis was performed using Propidium Iodide Flow Cytometry Kit (ab139418, Abcam) according to the manufacturer’s instructions. Briefly, cells were harvested with trypsin-EDTA treatment and dispersed into a single cell. Cells were fixed with ice-cold 66% (v/v) ethanol and then, incubated in propidium iodide fluorescence reagent for 30 min at room temperature. The proportion of cells in the Gap 1 phase (G1), DNA synthesis phase (S) and Gap 2 phase (G2) of the cell cycle were analyzed using the flow cytometry (BD Biosciences) and its associated FlowJo v10.8 software (BD Biosciences).

Statistical analysis

All statistical analyses were performed using GraphPad Prism 9 software (GraphPad Software Inc., San Diego, CA, USA). All results are presented as the means ± standard error of the mean (SEM) of at least three replicates. Student’s t-test was used for comparing the results between two groups. Results with p<0.05 were considered statistically significant (*p<0.05, **p<0.001, ***p<0.0005, and ****p<0.0001).

Senescence of HUVECs alters endothelial functions

The activity of SA-β-gal was significantly lower in young HUVECs than in senescent HUVECs (Fig. 1A). Wound healing was inhibited in senescent HUVECs monolayers compared to young HUVECs cultures over 8 h (Fig. 1B). Furthermore, the senescent HUVECs showed significantly decreased angiogenesis. Senescent HUVECs showed a significantly less meshes number in the basement membrane matrix than young HUVECs. In contrast, both the branching intervals and tube total length formed in the basement membrane matrix were markedly increased in young HUVECs (Fig. 1C).

Figure 1. Characterization of senescent HUVECs. (A) Representative images of young and senescent HUVECs stained for SA-β-gal are shown. Cells stained blue-green, indicating SA-β-gal activity. (B) Percentage of migrated area by HUVECs in young and senescent groups. (C) Quantification of the number of meshes, branching intervals and total tube length by HUVECs in young and senescent groups. Scale bar=100 μm. *p<0.05; or **p<0.005; ***p<0.0005; and ****p<0.0001 versus young HUVECs (n=3 per group).

Senescent HUVECs show the changes in both the levels of proteins and mRNAs of senescence-associated protein markers

The protein levels of senescence markers IL-17A, Ac-p53, p21^CIP1, and p16^INK4a were increased in senescent HUVECs (Fig. 2A). Similarly, the mRNA levels of IL-17A, p53, p21^CIP1, and p16^INK4a was significantly increased in senescent HUVECs than in young HUVECs (Fig. 2B). Endothelial nitric oxide synthase (eNOS) levels were decreased in endothelial cells with aging (Honda et al., 2021). Consistently, protein levels of eNOS and the phosphorylated form of eNOS (p-eNOS) were decreased in senescent HUVECs (Fig. 2C). Furthermore, the protein levels of SIRT1, Cyclin E, and CDK2 were decreased in senescent HUVECs (Fig. 2D, 2E). Moreover, the proportion of endothelial cells in the G1 phase was significantly increased, whereas that in the S/G2 phase was significantly decreased in senescent HUVECs compared to young HUVECs (Fig. 2F).

Figure 2. HUVECs senescence markers. (A) The protein levels of IL-17A, Ac-p53, p21^CIP1, and p16^INK4a in the various groups were determined by western blot analysis. (B) The mRNA levels of IL-17A, p53, p21^CIP1, and p16^INK4a in the various groups were measured by qRT-PCR. (C, D, E) The protein levels of eNOS, p-eNOS, SIRT1, Cyclin E, and CDK2 in various groups were determined by western blot analysis. (F) Cell cycle progression was assessed by flow cytometric analysis. The percentage of cells in G1 and S/G2 phases was quantified in young and senescent HUVECs. **p<0.005; and ****p<0.0001 versus young HUVECs (n=3 per group).

Both the protein and mRNA levels of HAPLN1 are decreased in senescent HUVECs

The protein levels of endogenous HAPLN1 were decreased in senescent HUVECs compared to young HUVECs (Fig. 3A). Similarly, mRNA levels of HAPLN1 were also significantly decreased in senescent HUVECs than in young HUVECs (Fig. 3B). These data suggest that senescence of HUVECs may be associated with a reduction in cellular levels of endogenous HAPLN1.

Figure 3. Endogenous HAPLN1 expression in HUVECs of differing passages. (A) The protein levels of HAPLN1 in the various groups were determined by western blot analysis. (B) The mRNA levels of HAPLN1 in the various groups were measured by qRT-PCR. **p<0.005 versus young HUVECs (n=3 per group).

rhHAPLN1 reverses the increased levels of SA–β-gal in senescence of HUVECs

A link between IL-17A and endothelial cell senescence has been reported (Zhang et al., 2021). When young HUVECs pretreated with rhHAPLN1 were stimulated with IL-17A, the increased activity of SA-β-gal by IL-17A was significantly reversed by the pre-treatment of rhHAPLN1 (Fig. 4A). Similar to these results, the activity of SA-β-gal in senescent HUVECs was also significantly reduced after rhHAPLN1 treatment (Fig. 4B). Our results suggest that rhHAPLN1 may suppress IL-17A-induced senescence and replicative senescence of HUVECs.

Figure 4. Roles of rhHAPLN1 in SA-β-gal activity. (A) Young HUVECs were cultured with 2.5 ng/mL rhHAPLN1 and/or 5 ng/mL IL-17A for 24 h and then stained for SA-β-gal. (B) Senescent HUVECs were cultured with 2.5 ng/mL rhHAPLN1 for 24 h and SA-β-gal staining was performed. Cells stained blue-green, indicating SA-β-gal activity. Scale bar=100 μm. ^#p<0.05 versus Control (young HUVECs). *p<0.05, **p<0.005 versus IL-17A treatment or Control (senescent HUVECs, n=3 per group).

rhHAPLN1 attenuates oxidative stress-induced senescence in HUVECs

ROS levels were significantly elevated in senescent HUVECs compared to the young HUVECs (Fig. 5A). When young HUVECs were subjected to H₂O₂ exposure, cellular ROS levels were increased, but this increase was reversed in the pre-treatment of rhHAPLN1 (Fig. 5A). Meanwhile, when senescent HUVECs were treated with rhHAPLN1, cellular ROS levels decreased following rhHAPLN1 treatment (Fig. 5A). This indicated that rhHAPLN1 protects HUVECs from oxidative stress. Likewise, rhHAPLN1 also decreased the mRNA expression of various senescence-associated secretory phenotypes (SASPs), including IL-17A, IL-1β, CCL2, and IL-6, in IL-17A-induced senescence as well as replicative senescence (Fig. 5B, 5C). Previous studies have shown that an increase in ROS levels decreases eNOS expression (Luo et al., 2018). In our data, rhHAPLN1 similarly increased the eNOS and phosphorylation of eNOS at serine-1177 (Fig. 5D, 5E). These data show that rhHAPLN1 may be critical for protecting HUVECs from oxidative stress and preventing apoptosis by increasing eNOS phosphorylation and by downregulating SASPs.

Figure 5. Effect of rhHAPLN1 on ROS levels and cell survival in HUVECs. (A) Young HUVECs were treated with rhHAPLN1 and then treated with H₂O₂. Cells were washed and stained with H2DCFDA. Senescent HUVECs were treated with rhHAPLN1, cells were washed and stained with H2DCFDA. The cellular ROS levels measured by flow cytometry (FACS). (B) The mRNA levels of IL-1β, CCL2, and IL-6 between the groups treated with IL-17A and rhHAPLN1 were determined by qRT-PCR. (C) Senescent HUVECs were treated with rhHAPLN1. The mRNA levels of IL-17A, IL-1β, CCL2, and IL-6 were determined by qRT-PCR. (D, E) The protein levels of eNOS and p-eNOS in the various groups were determined by western blot analysis. ^#p<0.05; ^##p<0.005; and ^###p<0.0005 versus Control (young HUVECs). **p<0.005; and ***p<0.0005 versus H₂O₂ treatment or IL-17A treatment or Control (senescent HUVECs, n=3 per group).

rhHAPLN1 restores proliferation of senescent HUVECs

To investigate the role of rhHAPLN1 in IL-17A-induced senescence of HUVECs and replicative senescence of HUVECs, the number of each population of cells in G1/S/G2 phases was measured (Fig. 6). Both the IL-17A-induced senescence and replicative senescence caused an increase in the percentage of cells in the G1 phase, with a concomitant decrease in cells in the S/G2 phase. Our results showed that rhHAPLN1 decreased the number of cells in the G1 phase of the cell cycle and increased the number in the S/G2 phase (Fig. 6A, 6B). This effect of rhHAPLN1 on the inhibition of such induced cell cycle arrest was further supported by increased levels of cell cycle proteins Cyclin E and CDK2 (Fig. 6C, 6D). Together, our results indicate that rhHAPLN1 restored the proliferation of the senescent HUVECs by upregulating expression of such cell cycle proteins and by promoting cell cycle progression.

Figure 6. Effect of rhHAPLN1 on cell proliferation in HUVECs. (A) Cell cycle progression was assessed by flow cytometric analysis. The percentage of cells in cell cycle G1 and S/G2 phases was quantified in young HUVECs treated with IL-17A and rhHAPLN1. (B) Cell cycle progression was assessed by flow cytometric analysis. The percentage of cells in the G1 and S/G2 phases was quantified in senescent HUVECs treated with rhHAPLN1. (C, D) The protein levels of Cyclin E and CDK2 in the various groups were determined by western blot analysis.

rhHAPLN1 restores angiogenic activity of senescent HUVECs via the tube-forming and migration potentials

To examine whether rhHAPLN1 acts as a stimulator of angiogenesis, we performed in vitro angiogenesis assay using two types of senescent HUVECs, IL-17A-induced senescence of HUVECs and replicative senescence of HUVECs. This assay involves endothelial tube formation and cell migration. The replicative senescence of HUVECs were used for the tube-formation assay (Arnaoutova and Kleinman, 2010). On the other hand, collective cell migration is also known to be linked to many physiological and pathological processes related to wound healing through the angiogenesis (Riahi et al., 2012). Firstly, for the tube-formation assay, when senescent HUVECs were treated with rhHAPLN1, the number of meshes, branching intervals, and total tube length were significantly increased (Fig. 7A). Furthermore, for the migration assay, when young HUVECs were stimulated with IL-17A, the area of the migration was decreased, but rhHAPLN1 treatment reversed significantly such decreasing effect of IL-17A (Fig. 7B). Similar increase in the area was observed in senescent HUVECs were treated with rhHAPLN1 (Fig. 7C). Together, these data indicate that rhHAPLN1 restores the endothelial angiogenesis as measured by the migration ability against IL-17A-induced senescence of HUVECs as well as by both the migration and tube-formation against replicative senescence of HUVECs.

Figure 7. Effect of rhHAPLN1 on migration and tube-forming in HUVECs. (A) Representative images of tube-forming capacity of senescent HUVECs were treated with rhHAPLN1. Quantification of the number of meshes, branching intervals and total tube length. (B, C) The wound pictures were captured by light microscope at 0 and 8 h, after which wound area was determined using ImageJ. Scale bar=100 μm. ^#p<0.05 versus Control (young HUVECs). *p<0.05; **p<0.005; and ***p<0.0005 versus IL-17A treatment or Control (senescent HUVECs, n=3 per group).

Relationship of rhHAPLN1 expression to SIRT1 levels

SIRT1 has been shown to control endothelial angiogenesis, and thus serve as a potential therapeutic target for vascular-related diseases in the adult (Potente et al., 2007). In this regard, we examined effects of rhHAPLN1 on SIRT1 and senescent markers, Ac-p53 and p21^CIP1 (Xiang et al., 2020), and p16^INK4a (Chen et al., 2014). Interestingly, rhHAPLN1 increased the protein level of SIRT1 in IL-17A-induced senescence of HUVECs and replicative senescence of HUVECs (Fig. 8A, 8B). Moreover, consistent with a recent study (Xiang et al., 2020), the protein levels of Ac-p53 and p21^CIP1 were decreased by rhHAPLN1 with the concurrent increase in SIRT1 levels (Fig. 8A, 8B). Along with this, p16^INK4a levels were also decreased by rhHAPLN1, suggesting that rhHAPLN1 may exert the effects of SIRT1 on mediating age-related DNA damage of HUVECs. To gain further understanding of the relationship between rhHAPLN1 and the senescence markers, including SIRT1, knockdown experiments via transfection of HAPLN1 siRNA were conducted. Our results demonstrated that the transfection of siRNA HAPLN1 decreased its mRNA level to 55% of that of cells transfected with control siRNA with concomitant decrease in SIRT1 expression levels as well as increases in the expression levels of p53, p21^CIP1, and p16^INK4a mRNA (Fig. 8C).

Figure 8. Effect of HAPLN1 siRNA on SIRT1 levels. (A, B) The protein levels of SIRT1, Ac-p53, p21^CIP1, and p16^INK4a in the various groups were determined by western blot analysis. (C) The levels of HAPLN1 mRNA in young HUVECs 24 h after transfection with control siRNA and siRNA against HAPLN1. Determination of SIRT1, p53, p21^CIP1, and p16^INK4a mRNA levels in HUVECs transfected with control siRNA or siRNA against HAPLN1. *p<0.05; or **p<0.005; and ***p<0.0005 versus control siRNA treatment (n=3 per group).

Age-related endothelial dysfunction is considered an important precursor of CVD development (Panza et al., 1990). Senescence compromises the crucial role of the endothelium in maintaining vascular homeostasis and promotes the development of age-related vascular diseases (Han and Kim, 2023). In this study, we provide the first evidence that rhHAPLN1 prevents replicative senescence, IL-17A-induced senescence, and oxidative stress-induced senescence in cultured human HUVECs. HAPLN1 can bind noncovalently to a specific region of a proteoglycan protein and an HA filament to stabilize the reversible non-covalent binding between the major ECM components. Thus, HA-proteoglycans complexes known as ‘aggregates’ are formed in the pericellular matrix (Hardingham, 1979; Buckwalter et al., 1984; Knudson and Knudson, 1993). The aggregate formed in the presence of HAPLN1, termed ‘HAPLN1-containing aggregate,’ is five times longer and has three times more PGs compared to the HAPLN1-free aggregate because the former leads to the increased stability of the linking between proteoglycans and HA (Buckwalter et al., 1984). Because of the presence of large amounts of polyanionic sugars within proteoglycans, HAPLN1 largely contributes to the formation of a water-rich and viscoelastic hydrogel matrix (Warren et al., 2021). Thus, HAPLN1-containing aggregates are important mechanochemical signal transducers in glycocalyx biology rather than acting as a passive HA coat that forms the interface of the cell with the extracellular space (Möckl, 2020).

The senescent phenotype not only arrests cell proliferation but also upregulates and secretes pro-inflammatory cytokines, ECM-degrading proteins, and growth factors, all of which represent the SASPs, and decreases the ability of cells to migrate (Coppé et al., 2010). The causes of cellular senescence include telomere shortening, genomic and epigenomic damage, unbalanced mitogenic signaling, and tumor suppressor protein activation (Campisi, 2013). Thus, cellular senescence participates in DNA damage, cell cycle arrest, and high levels of ROS generation by promoting the expression of senescence biomarkers, such as SA-β-gal, p53, p21, and p16. In addition, cellular senescence inhibits the expression of CDK-Cyclin (van Deursen, 2014; Davalli et al., 2016; Wang and Dreesen, 2018).

Our finding that senescent cells reduce expression of HAPLN1 strongly implies that HAPLN1 is related to cell senescence, which is consistent with our previous finding that the serum HAPLN1 levels decrease with age in mice (Fu et al., Hyaluronan and proteoglycan link 1- a novel signaling molecule for rejuvenating aged skin). SIRT1 expression has been shown to reduce with age in mouse and human arterial endothelial cells (Donato et al., 2011). Consistent with this finding, our data showed that SIRT1 levels decreased with senescence in endothelial cells. Moreover, siRNA-mediated knockdown of HAPLN1 expression not only reduced SIRT1 mRNA levels but also increased the levels of senescence marker protein p53, p21, and p16 (Fig. 8). Interestingly, rhHAPLN1 restored the protein levels of SIRT1, which were decreased by IL-17A-induced senescence of HUVECs and replicative senescence of HUVECs (Fig. 8). Furthermore, rhHAPLN1 substantially decreased the activity of SA-β-gal and down-regulated the levels of SASPs, including IL-17A, IL-1β, CCL2, and IL-6, in senescent HUVECs (Fig. 4, 5). Moreover, rhHAPLN1 reduced cellular ROS levels with replicative senescence- and H₂O₂-induced oxidative stress (Fig. 5), protecting HUVECs from oxidative stress, thus implying its prevention of premature senescence. Similarly, the expression of cell cycle arrest proteins, such as Ac-p53, p21^CIP1, and p16^INK4a was decreased by rhHAPLN1, whereas the expression of cyclin E/CDK2 was increased (Fig. 6). Additionally, consistent with these results, our data showed that rhHAPLN1 enhanced the angiogenic activities of senescent HUVECs, such as tube-forming ability and migration (Fig. 7).

SIRT1 is a longevity protein which is well-known to protect CVDs and is widely expressed in different endothelial cells (Chen et al., 2017). Previous studies have shown that p53, p16^INK4a, and p21^CIP1 are key signaling components of cellular senescence (Milanovic et al., 2018). Moreover, p16^INK4a expression increases with age and contributes to cellular senescence age-dependently cell senescence (Vassallo et al., 2014). In contrast, SIRT1 deacetylates Ac-p53 and inhibits p21 expression, which subsequently inhibits CDKs, and mediates cell cycle arrest during senescence (Xiang et al., 2020). Recent studies have also revealed that senescent markers, Ac-p53 and p21^CIP1 were up-regulated by down-regulation of SIRT1 levels via oxidative mechanism (Xiang et al., 2020), and both p16^INK4a and p21^CIP1 expression were negatively correlated with SIRT1 expression in mesenchymal stem cells, indicating that p16^INK4a and p21^CIP1 are both involved in SIRT1-mediated protection against DNA damage during cellular senescence (Chen et al., 2014). Furthermore, SIRT1 can significantly reduce the levels of the CDK inhibitor p16^INK4a (Huang et al., 2008; Vassallo et al., 2014). Meanwhile, it seems that SIRT1-knockdown stimulates p53 and p21^CIP1 protein levels expression in a deacetylase-independent manner (Fujino et al., 2018). Interestingly, a recent study showed that increased SIRT1 activation positively affects the expression of major ECM proteins, including HAPLN1, and SRT1720, an activator of SIRT1, can enhance the HAPLN1 gene expression (Smith et al., 2022). These findings prompted us to examine the effect of rhHAPLN1 on SIRT1 expression. In this context, we examined whether SIRT1 can be regulated by rhHAPLN1. Our data showed that rhHAPLN1 up-regulated SIRT1 levels and down-regulated the levels of Ac-p53, p21^CIP1, and p16^INK4a (Fig. 8), thereby implying its prevention from endothelial senescence. Most interestingly, together with the prior study, these results strongly suggest that there may exist a self-amplifying loop between SIRT1 and HAPLN1. Whether a cross-talk between CD44, p300, and SIRT1, as previously reported (Bourguignon et al., 2009), can explain how rhHAPLN1 up-regulates the levels of SIRT1 remains further investigated. On the other hand, activation of ROS signaling has been shown to lead to cellular senescence and cell cycle arrest; ROS levels are elevated in cells undergoing replicative senescence (Davalli et al., 2016). SIRT1 is known to play an important role in oxidative stress resistance via SIRT1/eNOS (Zhang et al., 2017). eNOS makes great contributions to oxidative stress resistance by producing NO and inhibiting O²⁻ generation (Forstermann and Sessa, 2012). Moreover, eNOS plays a role in migration and proliferation (Li et al., 2015). Our results revealed that rhHAPLN1 up-regulated both eNOS and p-eNOS levels, further suggesting that rhHAPLN1 restored the function activities of senescent HUVECs. No longer able to replicate or divide is characteristic of senescent cells. They exhibit different morphological characteristics, including cell size differences and flattened cell shapes, which are potential senescence markers (Wallis et al., 2022). Senescent cells are characterized by irreversible cell cycle arrest in the G1 phase (Gire and Dulic, 2015). Another prominent feature of senescent cells is increased SA-β-gal activity and SASP acquisition, including IL-1β, CCL2, and IL-6 (Wallis et al., 2022). In our study, the expression of SASPs and the activity of SA-β-gal were significantly decreased upon the treatment of rhHAPLN1 with senescent cells, further suggesting that rhHAPLN1 prevents cellular senescence in HUVECs.

Importantly, our results suggest that treating senescent HUVECs with rhHAPLN1 can restore impaired cellular functions, including proliferation, angiogenesis, and migration. Studies have shown that the functional activities of HUVECs are suppressed during replicative aging or cellular senescence and that SIRT1 overexpression enhances the proliferation and migration of endothelial cells (Li et al., 2015; Jia et al., 2019). Consistently, we showed that rhHAPLN1 increased the expression of cell cycle proteins Cyclin E and CDK2, stimulated the progression into the S/G2 phase of the cell cycle, and increased cell proliferation in senescent HUVECS.

In conclusion, the aim of the present study was to explore a protective role of rhHAPLN1 in vascular endothelial senescence and elucidate the mechanism of action. The results showed that rhHAPLN1 restored the functional activities by promoting angiogenetic activity, including tube-formation, migration, and cell cycle progression, in the IL-17A-induced and replicative senescence models of HUVECs. Such angiogenetic and anti-senescent effects of rhHAPLN1 are likely associated with the up-regulation of SIRT1 levels. Thus, although further preclinical trials are warranted to confirm the efficacy, rhHAPLN1 could be a novel and potential drug candidate for the treatment of age-related CVDs, including atherosclerosis.

This research was supported by a Chung-Ang University Young Scientist Scholarship in 2017, and a grant from the National Research Foundation of Korea (NRF-2017M3A9D8048414) funded by the Korean government (Ministry of Science and ICT).

D.Z., J.M.J., Z.F., and G.Y. are employees of HaplnScience Inc. J.M.J. and D.K.K. are shareholders of HaplnScience Inc. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.