Biomolecules & Therapeutics : eISSN 2005-4483 / pISSN 1976-9148

Table. 2.

Primers used for detecting specific botulinum toxin genes

Types Genes Primer sequences (5’-3’)
Type A BT(A)
Forward AGCTACGGAGGCAGCTATGTT
Reverse CGTATTTCCAAAGCTGAAAAGG
Type B BT(B)
Forward CAGGAGAAGTGGAGCGAAAA
Reverse CTTGCGCCTTTGTTTTCTTG
Type C BT(C)
Forward CCAAGATTTTCATCCGCCTA
Reverse GCTATTGATCCAAAACGGTGA
Type D BT(D)
Forward CGGCTTCATTAGAGAACGGA
Reverse TAACTCCCCTAGCCCCGTAT
Type E BT(E)
Forward CCAAGATTTTCATCCGCCTA
Reverse GCTATTGATCCAAAACGGTGA
Type F BT(F)
Forward CGGCTTCATTAGAGAACGGA
Reverse TAACTCCCCTAGCCCCGTAT

BT, Botulinum toxin.

Biomolecules & Therapeutics 2020;28:302~310 https://doi.org/10.4062/biomolther.2019.200
© Biomolecules & Therapeutics