Biomolecules & Therapeutics 2020; 28(4): 302-310  https://doi.org/10.4062/biomolther.2019.200
Alternative Methods for Testing Botulinum Toxin: Current Status and Future Perspectives
Mahesh Raj Nepal and Tae Cheon Jeong*
College of Pharmacy, Yeungnam University, Gyeongsan 38541, Republic of Korea
*E-mail: taecheon@ynu.ac.kr
Tel: +82-53-810-2819, Fax: +82-53-810-4654
Received: November 29, 2019; Revised: February 6, 2020; Accepted: February 17, 2020; Published online: March 4, 2020.
© The Korean Society of Applied Pharmacology. All rights reserved.

Abstract
Botulinum toxins are neurotoxic modular proteins composed of a heavy chain and a light chain connected by a disulfide bond and are produced by Clostridium botulinum. Although lethally toxic, botulinum toxin in low doses is clinically effective in numerous medical conditions, including muscle spasticity, strabismus, hyperactive urinary bladder, excessive sweating, and migraine. Globally, several companies are now producing products containing botulinum toxin for medical and cosmetic purposes, including the reduction of facial wrinkles. To test the efficacy and toxicity of botulinum toxin, animal tests have been solely and widely used, resulting in the inevitable sacrifice of hundreds of animals. Hence, alternative methods are urgently required to replace animals in botulinum toxin testing. Here, the various alternative methods developed to test the toxicity and efficacy of botulinum toxins have been briefly reviewed and future perspectives have been detailed.
Keywords: Botulinum toxin, Acetylcholine, In vitro, Alternative studies
INTRODUCTION

Clostridium botulinum is an anaerobic, gram-positive, spore-forming, rod-shaped bacterium that produces neurotoxic proteins called botulinum toxins (Nigam and Nigam, 2010). Food-borne poisoning cases of botulinum toxins were first observed in eighteenth-century Europe, and the condition was termed ‘sausage poisoning’ or botulism as ‘Botulus’ means sausage in Latin (Kerner, 1817). Depending on the type of illness caused by botulinum toxins, C. botulinum strains are divided into four different groups. Bacterial groups I and II are associated with the human illness, group III is associated with illness in animals, and group IV is not related to any illness (Nawrocki et al., 2018). So far, depending on the serological properties of the toxins, at least seven different types (A-G) of botulinum toxins have been identified from different C. botulinum strains (Nawrocki et al., 2018). Botulinum toxins A, B, and F are produced by group I bacteria, and toxins B, D, and E are produced by group II bacteria (Lindström and Korkeala, 2006). Botulinum toxin types A, B, and E have been identified as the most common neurotoxins causing human poisoning, whereas toxin types C and D are rarely associated with human toxicities; type F causes minimal human toxicity (Hodowanec and Bleck, 2015). In addition to C. botulinum, several other strains of bacteria can produce botulinum toxins, e.g., C. butyrricum, C. barati, and C. argentinensis (Hodowanec and Bleck, 2015; Pirazzini et al., 2017).

MECHANISM OF TOXICITY

Acetylcholine is a neurotransmitter that functions at neuromuscular junctions to activate muscles. For muscles to respond, several events are crucial (Fig. 1). First, three soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins, synaptobrevin, SNAP-25, and syntaxin, form a complex. Second, the synaptic vesicle and terminal membrane fuse to release acetylcholine into the synaptic cleft. Third, acetylcholine binds to the acetylcholine receptor in muscles and the muscle fibers contract (Fig. 1A). All serotypes of botulinum toxin consist of a 150-kDa, single-chain progenitor toxin, which can be triggered by a protease to produce a 100-kDa heavy chain and a 50-kDa light chain. When the toxin is internalized into nerve cells, the interchain disulfide bond is broken, releasing the light chain possessing endopeptidase activity. This light chain specifically cleaves one of the three SNARE proteins involved in neurotransmitter release (Hodowanec and Bleck, 2015; Pirazzini et al., 2017). This prevents the release of acetylcholine into the synaptic cleft by blocking membrane fusion. Hence, muscle cells stop responding. Therefore, an individual exposed to botulinum toxin could experience muscle paralysis (Fig. 1B; Dressler et al., 2005). Botulinum toxins can cause a rare but life-threatening condition called botulism, characterized by weakness, blurred vision, speech impairment, muscle cramps, vomiting, diarrhea, and fever. The estimated human lethal dose of botulinum toxins is 1.3-2.1 ng/kg when administered by the intravenous or intramuscular route and 10-13 ng/kg when administered by the inhalation route (Alshadwi et al., 2015; Lentz and Weingrow, 2018).

Figure 1. Mechanism of acetylcholine release at the junction of neurons and muscles. (A) Normal condition. (B) Action of botulinum toxin to prevent the release of acetylcholine into the synaptic cleft.

MEDICAL USES OF BOTULINUM TOXIN

Although botulinum toxins are considered to have high toxicity; however, in low doses, they have been extensively used to treat various clinical conditions. Among the seven different types of botulinum toxins, types A and B are most commonly used for medical purposes. Some medical uses are as follows.

Muscle spasticity

Botulinum toxin is used to treat several overactive muscle disorders, including post-stroke spasticity, spinal cord injury associated spasticity, head and neck spasms, and clenching of muscles of the esophagus, jaw, urinary bladder, and anus (Snow et al., 1990).

Excessive sweating

Acetylcholine facilitates sympathetic neurotransmission in the sweat glands. Bushara et al. (1996) and Heckmann et al. (2001) reported that injections of botulinum toxin A could inhibit excessive sweating by preventing the release of acetylcholine (Heckmann et al., 2001). In fact, the United States Food and Drug Administration (FDA) has approved botulinum toxin type A for use as a topical agent (Collins and Nasir, 2010).

Migraine

In patients with migraine, injection of low-dose purified botulinum toxin around the pain fibers prevented the release of chemicals involved in pain transmission and reduced the incidence of migraine (Silberstein et al., 2000). In 2010, FDA approved botulinum toxin injection for treating chronic migraine headaches (Escher et al., 2017).

Overactive bladder

Patients with an overactive bladder could be treated with a botulinum toxin injection into the walls of the urinary bladder, which reduces the urge for frequent urination (Duthie et al., 2011). Botulinum toxin prevented the vascular release of acetylcholine, reducing urinary bladder contraction and benefiting patients with a refractory overactive bladder. Thus, FDA has approved the use of botulinum toxin injection for an overactive bladder (Cox and Cameron, 2014).

Facial wrinkles

Botulinum toxin is considered safe for reducing facial wrinkles (Benedetto, 1999; Carruthers and Carruthers, 2002). It has been efficacious in relaxing wrinkled muscles, resulting in a smooth overlay skin; moreover, superior results were observed after few repeated injections (Benedetto, 1999; Carruthers and Carruthers, 2002). Notably, botulinum toxin selectively binds to the peripheral cholinergic motor neuron endplates to prevent the release of acetylcholine. Consequently, it paralyzes the involved muscles for a short period of up to 3 months (Small, 2014). However, the restoration of muscle functions can be observed shortly after the gradual formation of new motor endplates (Dressler et al., 2005).

IN VIVO TESTING OF BOTULINUM TOXINS FOR MEDICAL USE

Mouse lethality bioassay (MLB)

For botulinum toxin products used for medical purposes, animal testing has been exclusively employed for assessing efficacy and safety. The in vivo MLB is a standard test to evaluate the potency of botulinum toxin (Dressler et al., 2000; Lindström and Korkeala, 2006). In this assay, the biological activity of a sample is compared with that of standard samples. For decades, the LD50 assay has been the only method to determine the safety and potency of each batch of botulinum toxin manufactured for medical and cosmetic uses. Different doses of botulinum toxin are injected intraperitoneally into mice to assess mortality. Based on animal deaths observed in each group, the potency of botulinum toxin is calculated (Dressler et al., 2000; Lindström and Korkeala, 2006). MLB is very sensitive and has been reported a LD50 of 5-10 pg/mL for botulinum toxin (Dunning et al., 2014).

Limitations of MLB

The test endpoint of botulinum toxin testing is the painful death of animals following respiratory failure. Therefore, using a large number of animals for the efficacy/toxicity testing of botulinum toxins would be in disagreement with the 3R concepts (Reduction, Replacement, Refinement) adopted by the European Union and the Organization for Economic Co-operation and Development, which suggests the development of alternative test methods rather than using animals for such studies (Törnqvist et al., 2014). Scientists face an ethical dilemma to test botulinum toxins in animals as it overrules the scope of the aforementioned 3R concept by inducing distress and pain in animals, as well as inhumane practice that leads to death (Kang et al., 2018). Additionally, animal testing is a laborious and an expensive procedure requiring a sophisticated animal facility and a skilled and dedicated workforce. It has been estimated that for testing a single sample of botulinum toxin by MLB, 6-16 mice are required, with approximately 10 min for sample preparation and 2 days for toxicity manifestation in animals. However, this method has not been effective in detecting botulinum spores. Therefore, the occurrence of false positive results for C. botulinum spores would be high, creating a high chance of misreading results and false data interpretation.

In these regard, in recent years, there has been substantial progress regarding botulinum toxin testing in animals in Europe. However, these developments are still dependent on animal tests, inevitably causing severe pain and requiring a large number of animals. In addition, the paradigm for research has been evolving; human benefits do not justify harming animals anymore. Therefore, researchers have attempted to develop alternative testing methods for the safe use of botulinum toxin in humans (Taylor et al., 2019). Some of the currently available alternative methods were compiled in this review.

ALTERNATIVE METHODS DEVELOPED FOR BOTULINUM TOXIN TESTING

SNAP-25 assay

The sensitivity (<10 pg/mL) of this method is similar to that of the mouse bioassay. This assay system is faster, more automated, and can be adapted to several laboratory settings (Rasooly and Do, 2008; Yadirgi et al., 2017). During poisoning, the light chain of botulinum toxins selectively cleaves the intracellular synaptosome-associated protein of molecular mass 25-kDa (SNAP-25) (Keller and Neale, 2001). Scientists utilized this distinct mechanism and developed an in vitro method to measure the cleavage of SNAP-25 by employing fluorescence detection methods (Rasooly and Do, 2008; Yadirgi et al., 2017). The assay is performed in two simple steps. First, the toxin is immuno-separated and concentrated using immuno-magnetic beads with monoclonal antibodies directed against the 100-kDa heavy chain subunit. Second, the SNAP-25 peptide is cleaved by the toxin, labeled with fluorescent dyes, and detected by fluorescence resonance energy transfer-based techniques. The schemes for the detection of botulinum toxins A and E are illustrated in Fig. 2. This technique is very effective as an alternative for animal use in botulinum toxin testing (Yadirgi et al., 2017). When SNAP-25 is cloned to express large quantities in the pure form, animal use could be completely banned. In this assay, owing to the use of immune-magnetic beads, the botulinum toxin of interest could be concentrated in the given sample, demonstrating a sensitivity as high as that of MLB. However, this method does not involve all the critical steps of botulinum toxin poisoning, such as binding, internalization, and intracellular activity, and might lead to false results. Recently, with the development of a comprehensive panel of highly specific monoclonal neo-epitope antibodies, researchers could simultaneously detect at least two botulinum toxin serotypes (von Berg et al., 2019). The advances in the field of SNAP-25 assay could be considered a major step toward the replacement of MLB.

Figure 2. Schematic overview of immune-detection of toxin-cleaved SNAP-25. Toxin A cleaves SNAP-25 in neurons between the 197th and 198th amino acids, and toxin E cleaves between the 180th and 181st amino acids. The cleaved fragments bind to their specific antibodies and are caught by neo-epitope antibodies produced against the peptides corresponding to SNAP-25190-197 and SNAP-25173-180. The antibodies only detect the toxin-cleaved SNAP-25 fragment and would not bind to intact SNAP-25. The captured cleavage product is then detected using two polyclonal detection antibodies that bind to two distinct sites, SNAP-251-57 and SNAP-25111-157.

Ex vivo assays

Mouse phrenic nerve hemidiaphragm (MPN) test: The MPN test is an ex vivo study employing isolation of the hemidiaphragm muscle with the attached phrenic nerve from euthanized mice. This test was first described by Bülbring in 1946 using the rat phrenic nerve and was later adopted and modified using the mice phrenic nerve (Bülbring, 1946; Bigalke and Rummel, 2015). Although a dramatic increase in sensitivity was observed from rats to mice, the observed paralytic half time was similar (Bigalke and Rummel, 2015). This assay closely imitates MLB by mimicking in vivo respiratory paralysis. The phrenic nerve originates in the neck (C3-C5) and passes down between the lung and heart to reach the diaphragm. The use of both halves of the diaphragm could reduce the animal use by half; however, as the right phrenic nerve is present behind vital organs and is closely attached to main blood vessels, this method uses only the left phrenic nerve hemidiaphragm for successful dissection (Bigalke and Rummel, 2015). In this assay, the excised phrenic nerve is placed in an organ bath maintained with optimized pH, O2, and CO2 levels and is continuously electro-stimulated at a frequency of 1 Hz with two electrodes. Then, the isometric contraction amplitude is measured to analyze the data obtained. Next, the incubation solution is replaced with the botulinum toxin-containing solution and the reduction in contraction amplitude is measured. The time required for the reduction of 50% amplitude is determined as the assay endpoint (Bigalke and Rummel, 2015). In this method, botulinum toxins (A, B and E) demonstrated a dose-dependent decrease in the contraction amplitude of the stimulated muscle. An excellent correlation of 0.96-0.99 was achieved between MPN and MLB for all botulinum toxins tested (Table 1; Rasetti-Escargueil et al., 2011).

Table 1 . Summary of the methods for detecting botulinum toxins

MLBSNAP-25 assayMPNNFPAImmuno-assaysCatalytic activity assaysCell-based assayNucleic acid-based assay
Sensitivity (pg/mL)<10a(0.3-80)b(30-50)c<10a,d(0.2-2.2)e,f(0.1-1,000)g~3h(1-5)i
Duration (including sample preparation time, day)>5j<1j<1j>2j<1j<1jVariablej(1-2)j
Correlation with MLB-0.95k(0.96-0.99)l0.98m0.94n(0.85-0.97)oN/AN/A
Serotypes detected(A, B, C, D, E, F, G)p(A, B, C, D, E, F, G)b(A, B, E)c(A, B)q(A, B, E, F)r(A, B, E, F)s,t(A, B, E)u(A, B, E, F)v
Experimental designin vivoin vitroex vivoex vivoin vitroin vitroin vitroin vitro

MLB, mouse lethality bioassay; MPN, mouse phrenic nerve hemidiaphragm test; NFPA, non-lethal mouse flaccid paralysis assay; N/A, not available.

References: aWictome et al. (1999); bvon Berg et al. (2019); cBigalke and Rummel (2015); dWilder-Kofie et al. (2011); eCheng and Stanker (2013); fSharma et al. (2006); gKalb et al. (2015); hRust et al. (2017); iČapek and Dickerson (2010); jStephens (2005); kEkong et al. (1997); lRasetti-Escargueil et al. (2011); mSesardic et al. (1996); nZechmeister et al. (2002); oBjörnstad et al. (2014); pDunning et al. (2014); qSesardic and Das (2007); rFerreira (2001); sRosen et al. (2017); tBoyer et al. (2005); uMcNutt et al. (2013); vCheng et al (2016).


Although animals are inevitably sacrificed to prepare the phrenic nerve, this is an improved test owing to the reduced animal use. MPN can determine the presence of botulinum toxins, along with their efficacy, potency, and concentration in the given sample. Therefore, this method could be considered more precise than MLB. However, it requires experienced and skilled personnel and only a limited number of samples can be analyzed in a single assay. Moreover, as the test only identifies active botulinum toxins, if the samples contain inactivated or denatured toxins and other muscle-paralyzing agents, the test may produce false results (Bigalke and Rummel, 2015).

Non-lethal mouse flaccid paralysis assay (NFPA): NFPA is an ex vivo local paralysis assay that is considered less severe, more economical, more sensitive, and a refinement of the mouse LD50 assay. This assay uses mouse paralysis as the endpoint to determine the potency of botulinum toxin type A (Sesardic and Das, 2007). The extent of paralysis reflects the potency of the toxin. This method evaluates exposure to botulinum toxin type A by employing the stimulated rodent diaphragm or rat intercostal muscle. This method has several advantages over the conventional method, MLB. Here, the endpoint is more humane compared with that in MLB, with only a 4% reduction in animal body weight observed during the test (Sesardic and Das, 2007). Furthermore, in this method, the endpoint is evaluated locally, thus avoiding systemic toxicity, including death in mice. Moreover, the endpoint of paralysis can be observed within 24-48 h, which is considerably shorter than 72-96 h required to observe the endpoint in acute toxicity (LD50) testing. This method has been validated at the National Institute for Biological Standards and Control (UK) and has been accepted as an alternative method to test the potency of botulinum toxin in the European Pharmacopoeia (Sesardic and Das, 2007).

Furthermore, to perform this method, no specialized equipment is required, and only 20% of the animals used for MLB are used for this assay (Sesardic and Das, 2007). A correlation of 98% was achieved when compared with MLB. Additionally, the mean difference between the estimated potency in the two assays was not statistically significant (Sesardic et al., 1996). A linear relationship was achieved between the mean scores of response vs toxin doses, which proved that the developed method was sensitive and highly efficient for the determination of botulinum toxins. With the confidence interval of 95%, the geometric coefficient of variation within assays was achieved as 16%. In this method, the accuracy and precision obtained using sub-lethal doses of botulinum toxin were comparable to the MLB, confirming that the FDA and other regulatory agencies can accept the assay method as a replacement for MLB.

Immunoassays

Immunoassays offer the simple, quick, sensitive, and reproducible detection of botulinum toxins, providing both qualitative and quantitative evidence (Lindström and Korkeala, 2006; Thirunavukkarasu et al., 2018). These measure the interaction between the protein antigen from pathogenic organisms and the antibody (Lindström and Korkeala, 2006; Sharma et al., 2006; Rasooly and Do, 2008). Classical enzyme-linked immunosorbent assay (ELISA) has been employed for the detection of botulinum toxins. However, the sensitivity of detection for botulinum toxins obtained by employing standard ELISA was moderately less than that obtained using mouse bioassays (Lindström and Korkeala, 2006; Sharma et al., 2006; Rasooly and Do, 2008). Nevertheless, signal amplification methods, such as the chromogenic diaphorase system, have been utilized to increase the sensitivity to that of MLB (Lindström and Korkeala, 2006; Sharma et al., 2006; Rasooly and Do, 2008). Usually, monoclonal or polyclonal antibodies are used for the detection of various serotypes of botulinum toxins (Cai et al., 2007; Čapek and Dickerson, 2010). In contrast to MLB, immunoassays have excellent dynamic ranges of quantification based on sample dilution. Furthermore, immunoassays are cost-effective, requiring fewer instruments that do not need skilled personnel. A major limitation of this method is the use of high-quality antibodies, which are costly and difficult to produce. Moreover, chances for false positive results are relatively high owing to the heat-inactivation of toxins (Lindström and Korkeala, 2006). Additionally, the sensitivity of assay varies between samples and botulinum toxin serotypes. The detection limit for botulinum toxin type A, B, E, and F by ELISA techniques was calculated as 60, 176, 163, and 117 pg/mL, respectively (Lindström and Korkeala, 2006; Sharma et al., 2006; Rasooly and Do, 2008). The tests readily detected 2 ng/mL of serotypes A, B, E, and F in a variety of tested foods (Cheng et al., 2012). In addition, with the development of high-affinity antibodies, ELISA based systems could detect botulinum toxins serotypes A, B, C, D, E, and F with concentrations ranging from 0.2 to 2.2 pg/mL (Zhang et al., 2012). FDA has accepted ELISA for the detection of botulinum toxins A, B, E, and F (Food and Drug Administration, 2017). However, positive samples determined using ELISA need to confirmed by MLB.

Another immunoassay approach is the electro-chemiluminescence (ECL) method (Cheng and Stanker, 2013). The ECL approach uses a format similar to ELISA. The output signal is produced by enzymatic hydrolysis of certain substrates in ELISA; however, ECL uses a luminescent signal generated by electron cycling of the ruthenium label. In this method, electrochemically generated intermediates undergo a highly exergonic reaction to yield an electronically excited state discharging light upon relaxation to a lower-level state (Forster et al., 2009; Valenti et al., 2016). The ECL microplate consists of a carbon electrode surface that uses ruthenium labeled antitoxins. When these antibodies detect botulinum toxins, luminescence occurs (Cheng and Stanker, 2013). Briefly, the ECL standard samples in a 96-well plate are treated with anti-botulinum toxin antibodies, and the amount of toxin present in each sample is determined by comparing the unknown signal to the standard curve signal. In this method, the limit of detection was 3 pg/mL for botulinum toxin-serotype A and 13 pg/mL for botulinum toxin-serotype B (Cheng and Stanker, 2013). However, such methods only provide information on the amount of protein and do not reflect the biological potency of toxins.

Assays for the catalytic activity of botulinum toxin

Botulinum toxins can be detected and identified by determining the catalytic activity of their endopeptidase domain (Parks et al., 2011). Theoretically, every botulinum toxin has a unique substrate cleavage site(s). Hence, an in vitro assay that could identify the specific target substrate and endopeptidase activity could be utilized to determine the specific botulinum toxin (Björnstad et al., 2014; Rosen et al., 2015). Recently, the Endopep-MS assay using a combination of botulinum toxin endopeptidase enzyme activity with mass spectrometry was developed to determine the specific location of the cleaved substrate (Björnstad et al., 2014; Rosen et al., 2015). This test effectively determines botulinum toxin levels in clinical samples, food samples, and cultures. In addition, this assay system is rapid, reliable, and robust to detect and differentiate various serotypes of botulinum toxins (Björnstad et al., 2014; Rosen et al., 2015). Kalb et al. (2015) recently developed an assay system that incorporates serotype-specific, high-affinity monoclonal antibodies for binding to the heavy chains of different botulinum toxins. This enables the Endopep-MS assay to attain higher sensitivity that is comparable with or more sensitive than the conventional method MLB (100 fg/mL-1 ng/mL) (Kalb et al., 2015).

Recently, researchers assessed the enzymatic activity of botulinum toxin by using immunoassay techniques including ELISA, which was capable of detecting three botulinum toxin serotypes, A, B, and E (Rhéaume et al., 2015; Simon et al., 2015). The Endopep-ELISA uses monoclonal antibodies that do not bind with substrate molecules in the uncleaved state, binding specifically to the new binding site of epitopes, generated following the cleavage of target substrates (Wictome et al., 1999; Nuss et al., 2010). The sensitivity obtained with this method was comparable to or even exceeded MLB (Rhéaume et al., 2015; Simon et al., 2015). This method can evaluate botulinum toxin levels in clinical samples, food samples, and cultures; however, this method identifies only a few serotypes (Kalb et al., 2015).

Cell-based assay

Cell-based assays are viable in vitro options that could detect fully functional botulinum toxins in a single assay. Over the past 5 years, assays for several botulinum toxins based on cell levels have been established, with the potency of botulinum toxins quantitatively evaluated with a similar or higher tolerance than the mouse bioassay (Pellett, 2013). Stem cell- and neurogenic cell line-based assays have been used for the identification of biological activities of the botulinum toxins (Maslanka et al., 2011; McNutt et al., 2013; Thirunavukkarasu et al., 2018). Stem cell- or neurogenic cell line-based assays offer comparable sensitivity to MLB for the detection of botulinum toxin. However, the time period required for performing the assay was similar to the MLB. In this assay system, cells are incubated with botulinum toxins for a defined period (24-72 h), followed by the removal of toxins, and the determination of toxin activity in cells (Pellett, 2013). To quantitate the toxin activity in cells, the cleavage of SNARE proteins was determined by either ELISA or Western blotting in cell lysates (Pellett, 2013). Alternatively, the toxin activity could be determined in live cells by immune-fluorescence methods by using cleavage-specific antibodies (Kiris et al., 2011). Another significant, but less precise endpoint, is the determination of the release of neurotransmitters, that can be assessed in primary neuronal cell cultures and neurons originating from stem cells, as well as in certain continuous cell lines (Bigalke and Rummel, 2015). For these assays, well-differentiated human or mouse neural cells, or embryogenic or induced pluripotent stem cells are required. The cell-based botulinum toxin test was validated and approved by the US FDA, Health Canada, and the European Union for testing botulinum toxin-based products (Fernandez-Salas et al., 2012). The main advantage of the cell-based assay system is reduced number of animals compared with MLB (Thirunavukkarasu et al., 2018). However, the major limitations of this method were sample-to-sample variation in results, limited number of samples in a single assay, and the requirement of skilled workforce with appropriate facilities for the cell studies (Thirunavukkarasu et al., 2018).

Nucleic acid-based methods

Several nucleic acid-based methods have been used to identify the presence of botulinum neurotoxin in clinical and environmental samples, food, and pharmaceutical products (Thirunavukkarasu et al., 2018). Using polymerase chain reaction (PCR), specific genes that encode bacterial toxins could be amplified, providing insights on the toxin-producing ability of the sample organism (Szabo et al., 1993; Lindström and Korkeala, 2006; Peck, 2006; Fach et al., 2009). Therefore, the botulinum toxin gene from different strains of C. botulinum can be amplified, and the type of toxicity imparted by each strain of bacteria can be estimated (Raphael, 2012; Smith et al., 2015). A series of PCR primers were designed, and genes that compose the toxin capable of producing toxicities were determined, as shown in Table 2 (Lindström et al., 2001; de Medici et al., 2009). However, this nucleic acid-based assay would only be effective in the presence of toxin-producing bacteria in tested samples. This method demonstrates a similar sensitivity to MLB. However, this method requires skilled workforce for using complex instruments and requires substantial time for analysis compared with other in vitro methods. The US FDA has accepted the PCR method for the detection of botulinum toxins A, B, E, and F (Food and Drug Administration, 2017). However, positive test samples determined by PCR should be confirmed by in vivo MLB.

Table 2 . Primers used for detecting specific botulinum toxin genes

TypesGenesPrimer sequences (5’-3’)
Type ABT(A)
ForwardAGCTACGGAGGCAGCTATGTT
ReverseCGTATTTCCAAAGCTGAAAAGG
Type BBT(B)
ForwardCAGGAGAAGTGGAGCGAAAA
ReverseCTTGCGCCTTTGTTTTCTTG
Type CBT(C)
ForwardCCAAGATTTTCATCCGCCTA
ReverseGCTATTGATCCAAAACGGTGA
Type DBT(D)
ForwardCGGCTTCATTAGAGAACGGA
ReverseTAACTCCCCTAGCCCCGTAT
Type EBT(E)
ForwardCCAAGATTTTCATCCGCCTA
ReverseGCTATTGATCCAAAACGGTGA
Type FBT(F)
ForwardCGGCTTCATTAGAGAACGGA
ReverseTAACTCCCCTAGCCCCGTAT

BT, Botulinum toxin.


MECHANISM OF TOXICITY

Acetylcholine is a neurotransmitter that functions at neuromuscular junctions to activate muscles. For muscles to respond, several events are crucial (Fig. 1). First, three soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins, synaptobrevin, SNAP-25, and syntaxin, form a complex. Second, the synaptic vesicle and terminal membrane fuse to release acetylcholine into the synaptic cleft. Third, acetylcholine binds to the acetylcholine receptor in muscles and the muscle fibers contract (Fig. 1A). All serotypes of botulinum toxin consist of a 150-kDa, single-chain progenitor toxin, which can be triggered by a protease to produce a 100-kDa heavy chain and a 50-kDa light chain. When the toxin is internalized into nerve cells, the interchain disulfide bond is broken, releasing the light chain possessing endopeptidase activity. This light chain specifically cleaves one of the three SNARE proteins involved in neurotransmitter release (Hodowanec and Bleck, 2015; Pirazzini et al., 2017). This prevents the release of acetylcholine into the synaptic cleft by blocking membrane fusion. Hence, muscle cells stop responding. Therefore, an individual exposed to botulinum toxin could experience muscle paralysis (Fig. 1B; Dressler et al., 2005). Botulinum toxins can cause a rare but life-threatening condition called botulism, characterized by weakness, blurred vision, speech impairment, muscle cramps, vomiting, diarrhea, and fever. The estimated human lethal dose of botulinum toxins is 1.3-2.1 ng/kg when administered by the intravenous or intramuscular route and 10-13 ng/kg when administered by the inhalation route (Alshadwi et al., 2015; Lentz and Weingrow, 2018).

ACKNOWLEDGMENTS

This work was supported by a grant from the National Research Foundation, Korea (NRF-2017RIDIA3B04033313).

References
  1. Alshadwi, A., Nadershah, M. and Osborn, T. (2015) Therapeutic applications of botulinum neurotoxins in head and neck disorders. Saudi Dent. J. 27, 3-11.
    Pubmed KoreaMed CrossRef
  2. Benedetto, A. V. (1999) The cosmetic uses of botulinum toxin type A. Int. J. Dermatol. 38, 641-655.
    Pubmed CrossRef
  3. Bigalke, H. and Rummel, A. (2015) Botulinum neurotoxins: qualitative and quantitative analysis using the mouse phrenic nerve hemidiaphragm assay (MPN). Toxins 7, 4895-4905.
    Pubmed KoreaMed CrossRef
  4. Björnstad, K., Åberg, A. T., Kalb, S. R., Wang, D., Barr, J. R., Bondesson, U. and Hedeland, M. (2014) Validation of the Endopep-MS method for qualitative detection of active botulinum neurotoxins in human and chicken serum. Anal. Bioanal. Chem. 406, 7149-7161.
    Pubmed KoreaMed CrossRef
  5. Boyer, A. E., Moura, H., Woolfitt, A. R., Kalb, S. R., McWilliams, L. G., Pavlopoulos, A., Schmidt, J. G., Ashley, D. L. and Barr, J. R. (2005) From the mouse to the mass spectrometer: detection and differentiation of the endoproteinase activities of botulinum neurotoxins A-G by mass spectrometry. Anal. Chem. 77, 3916-3924.
    Pubmed CrossRef
  6. Bulbring, E. (1946) Observations on the isolated phrenic nerve diaphragm preparation of the rat. Br. J. Pharmacol. Chemother. 1, 38-61.
    Pubmed KoreaMed CrossRef
  7. Bushara, K. O., Park, D. M., Jones, J. C. and Schutta, H. S. (1996) Botulinum toxin-a possible new treatment for axillary hyperhidrosis. Clin. Exp. Dermatol. 21, 276-278.
    Pubmed CrossRef
  8. Cai, S., Singh, B. R. and Sharma, S. (2007) Botulism diagnostics: from clinical symptoms to in vitro assays. Crit. Rev. Microbiol. 33, 109-125.
    Pubmed CrossRef
  9. Čapek, P. and Dickerson, T. (2010) Sensing the deadliest toxin: technologies for botulinum neurotoxin detection. Toxins 2, 24-53.
    Pubmed KoreaMed CrossRef
  10. Carruthers J. D. and Carruthers A. (2002) Cosmetic use of botulinum toxin for treatment of downturned mouth. United States patent US6358917B1.
  11. Cheng, L. W., Land, K. M. and Stanker, L. H. (2012) Current methods for detecting the presence of botulinum neurotoxins in food and other biological samples. In: Bioterrorism (Morse, S. A., Ed.), , pp. 1-18IntechOpen, London.
  12. Cheng, L. W. and Stanker, L. H. (2013) Detection of botulinum neurotoxin serotypes A and B using a chemiluminescent versus electrochemiluminescent immunoassay in food and serum. J. Agric. Food Chem. 61, 755-760.
    Pubmed KoreaMed CrossRef
  13. Cheng, W., Land, M., Tam, C., Brandon, D. L. and Stanker, H. (2016) Technologies for detecting botulinum neurotoxins in biological and environmental matrices. In: Significance, Prevention and Control of Food Related Diseases (Makun, H., Ed.), , pp. 125-144InTech, London.
    CrossRef
  14. Collins, A. and Nasir, A. (2010) Topical botulinum toxin. J. Clin. Aesthet. Dermatol. 3, 35-39.
    Pubmed KoreaMed CrossRef
  15. Cox, L. and Cameron, A. P. (2014) OnabotulinumtoxinA for the treatment of overactive bladder. Res. Rep. Urol. 6, 79-89.
    Pubmed KoreaMed CrossRef
  16. Dressler, D., Dirnberger, G., Bhatia, K. P., Irmer, A., Quinn, N. P., Bigalke, H. and Marsden, C. D. (2000) Botulinum toxin antibody testing: comparison between the mouse protection assay and the mouse lethality assay. Mov. Disord. 15, 973-976.
    CrossRef
  17. Dressler, D., Saberi, F. A. and Barbosa, E. R. (2005) Botulinum toxin: mechanisms of action. Arq. Neuropsiquiatr. 63, 180-185.
    Pubmed CrossRef
  18. Dunning, F. M., Piazza, T. M., Zeytin, F. N. and Tucker, W. C. (2014) Isolation and quantification of botulinum neurotoxin from complex matrices using the BoTest matrix assays. J. Vis. Exp. 3, e51170.
    Pubmed KoreaMed CrossRef
  19. Duthie, J. B., Vincent, M., Herbison, G. P., Wilson, D. I. and Wilson, D. (2011) Botulinum toxin injections for adults with overactive bladder syndrome. Cochrane Database Syst. Rev. 7, CD005493.
    Pubmed CrossRef
  20. Ekong, T. A., Feavers, I. M. and Sesardic, D. (1997) Recombinant SNAP-25 is an effective substrate for Clostridium botulinum type A toxin endopeptidase activity in vitro. Microbiology 143, 3337-3347.
    Pubmed CrossRef
  21. Escher, C. M., Paracka, L., Dressler, D. and Kollewe, K. (2017) Botulinum toxin in the management of chronic migraine: clinical evidence and experience. Ther. Adv. Neurol. Disord. 10, 127-135.
    Pubmed KoreaMed CrossRef
  22. Fach, P., Micheau, P., Mazuet, C., Perelle, S. and Popoff, M. (2009) Development of real-time PCR tests for detecting botulinum neurotoxins A, B, E, F producing Clostridium botulinum, Clostridium baratii and Clostridium butyricum. J. Appl. Microbiol. 107, 465-473.
    Pubmed CrossRef
  23. Food and Drug Administration. (2017) Laboratory methods: bacteriological analytical manual (BAM). Available from: https://www.fda.gov/food/laboratory-methods-food/bam-clostridium-botulinum/.
  24. Fernandez-Salas, E., Wang, J., Molina, Y., Nelson, J. B., Jacky, B. P. and Aoki, K. R. (2012) Botulinum neurotoxin serotype A specific cell-based potency assay to replace the mouse bioassay. PLoS ONE 7, e49516.
    Pubmed KoreaMed CrossRef
  25. Ferreira, J. L. (2001) Comparison of amplified ELISA and mouse bioassay procedures for determination of botulinal toxins A, B, E, and F. J. AOAC Int. 84, 85-88.
    CrossRef
  26. Forster, R. J., Bertoncello, P. and Keyes, T. E. (2009) Electrogenerated chemiluminescence. Annu. Rev. Anal. Chem. 2, 359-385.
    Pubmed CrossRef
  27. Heckmann, M., Ceballos-Baumann, A. O. and Plewig, G. (2001) Botulinum toxin A for axillary hyperhidrosis (excessive sweating). N. Engl. J. Med. 344, 488-493.
    Pubmed CrossRef
  28. Hodowanec, A. and Bleck, T. P. (2015) Botulism (Clostridium botulinum). In: Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases (Bennett, J. E., Dolin, R. and Blaser, M. J., Eds.), , pp. 2763-2767.e28th ed. Elsevier, Philadelphia.
  29. Kalb, S., Baudys, J., Wang, D. and Barr, J. (2015) Recommended mass spectrometry-based strategies to identify botulinum neurotoxin-containing samples. Toxins 7, 1765-1778.
    Pubmed KoreaMed CrossRef
  30. Kang, M., Han, A., Kim, D. E., Seidle, T., Lim, K. M. and Bae, S. (2018) Mental stress from animal experiments: a survey with Korean researchers. Toxicol. Res. 34, 75-81.
    Pubmed KoreaMed CrossRef
  31. Keller, J. E. and Neale, E. A. (2001) The role of the synaptic protein snap-25 in the potency of botulinum neurotoxin type A. J. Biol. Chem. 276, 13476-13482.
    Pubmed CrossRef
  32. Kerner, J. (1817) Vergiftung durch verdorbene Würste. Tübinger Blätt Naturwissenschaften Arzneykunde 3, 1-25.
  33. Kiris, E., Nuss, J. E., Burnett, J. C., Kota, K. P., Koh, D. C., Wanner, L. M., Torres-Melendez, E., Gussio, R., Tessarollo, L. and Bavari, S. (2011) Embryonic stem cell-derived motoneurons provide a highly sensitive cell culture model for botulinum neurotoxin studies, with implications for high-throughput drug discovery. Stem Cell Res. 6, 195-205.
    Pubmed KoreaMed CrossRef
  34. Lentz, J. and Weingrow, D. (2018) Bulbar muscle weakness in the setting of therapeutic botulinum injections. Clin. Pract. Cases Emerg. Med. 2, 330-333.
    Pubmed KoreaMed CrossRef
  35. Lindström, M. and Korkeala, H. (2006) Laboratory diagnostics of botulism. Clin. Microbiol. Rev. 19, 298-314.
    Pubmed KoreaMed CrossRef
  36. Lindström, M., Keto, R., Markkula, A., Nevas, M., Hielm, S. and Korkeala, H. (2001) Multiplex PCR assay for detection and identification of Clostridium botulinum types A, B, E, and F in food and fecal material. Appl. Environ. Microbiol. 67, 5694-5699.
    Pubmed KoreaMed CrossRef
  37. Maslanka, S. E., Luquez, C., Raphael, B. H., Dykes, J. K. and Joseph, L. A. (2011) Utility of botulinum toxin ELISA A, B, E, F kits for clinical laboratory investigations of human botulism. Botulinum J. 2, 72-92.
    CrossRef
  38. McNutt, P., Beske, P. and Thirunavukkarsu, N. (2013) Cell-based assays for neurotoxin studies. In: Biological Toxins and Bioterrorism (Gopalakrishnakone, P., Balali-Mood, M., Llewellyn, L. and Singh, B. R., Eds.), , pp. 247-271Springer.
    CrossRef
  39. de Medici, D., Anniballi, F., Wyatt, G. M., Lindström, M., Messelhäusser, U., Aldus, C. F., Delibato, E., Korkeala, H., Peck, M. W. and Fenicia, L. (2009) Multiplex PCR for detection of botulinum neurotoxin-producing clostridia in clinical, food, and environmental samples. Appl. Environ. Microbiol. 75, 6457-6461.
    Pubmed KoreaMed CrossRef
  40. Nawrocki, E. M., Bradshaw, M. and Johnson, E. A. (2018) Botulinum neurotoxin-encoding plasmids can be conjugatively transferred to diverse clostridial strains. Sci. Rep. 8, 3100.
    Pubmed KoreaMed CrossRef
  41. Nigam, P. K. and Nigam, A. (2010) Botulinum toxin. Indian J. Dermatol. 55, 8-14.
    Pubmed KoreaMed CrossRef
  42. Nuss, J. E., Ruthel, G., Tressler, L. E., Wanner, L. M., Torres-Melendez, E., Hale, M. L. and Bavari, S. (2010) Development of cell-based assays to measure botulinum neurotoxin serotype A activity using cleavage-sensitive antibodies. J. Biomol. Screen. 15, 42-51.
    Pubmed CrossRef
  43. Parks, B. A., Shearer, J. D., Baudys, J., Kalb, S. R., Sanford, D. C., Pirkle, J. L. and Barr, J. R. (2011) Quantification of botulinum neurotoxin serotypes A and B from serum using mass spectrometry. Anal. Chem. 83, 9047-9053.
    Pubmed CrossRef
  44. Peck, M. (2006) Clostridiumbotulinum and the safety of minimally heated, chilled foods: an emerging issue? J. Appl. Microbiol. 101, 556-570.
    Pubmed CrossRef
  45. Pellett, S. (2013) Progress in cell based assays for botulinum neurotoxin detection. Curr. Top. Microbiol. Immunol. 364, 257-285.
    Pubmed KoreaMed CrossRef
  46. Pirazzini, M., Rossetto, O., Eleopra, R. and Montecucco, C. (2017) Botulinum neurotoxins: biology, pharmacology, and toxicology. Pharmacol. Rev. 69, 200-235.
    Pubmed KoreaMed CrossRef
  47. Raphael, B. H. (2012) Exploring genomic diversity in Clostridium botulinum using DNA microarrays. Botulinum J. 2, 99-108.
    CrossRef
  48. Rasetti-Escargueil, C., Liu, Y., Rigsby, P., Jones, R. G. A. and Sesardic, D. (2011) Phrenic nerve-hemidiaphragm as a highly sensitive replacement assay for determination of functional botulinum toxin antibodies. Toxicon 57, 1008-1016.
    Pubmed CrossRef
  49. Rasooly, R. and Do, P. M. (2008) Development of an in vitro activity assay as an alternative to the mouse bioassay for Clostridium botulinum neurotoxin type A. Appl. Environ. Microbiol. 74, 4309-4313.
    Pubmed KoreaMed CrossRef
  50. Rhéaume, C., Cai, B., Wang, J., Fernández-Salas, E., Aoki, K., Francis, J. and Broide, R. (2015) A highly specific monoclonal antibody for botulinum neurotoxin type A-cleaved SNAP25. Toxins 7, 2354-2370.
    Pubmed KoreaMed CrossRef
  51. Rosen, O., Feldberg, L., Yamin, T. S., Dor, E., Barnea, A., Weissberg, A. and Zichel, R. (2017) Development of a multiplex Endopep-MS assay for simultaneous detection of botulinum toxins A, B and E. Sci. Rep. 7, 14859.
    Pubmed KoreaMed CrossRef
  52. Rosen, O., Feldberg, L., Gura, S. and Zichel, R. (2015) A new peptide substrate for enhanced botulinum neurotoxin type B detection by endopeptidase-liquid chromatography-tandem mass spectrometry/multiple reaction monitoring assay. Anal. Biochem. 473, 7-10.
    Pubmed CrossRef
  53. Rust, A., Doran, C., Hart, R., Binz, T., Stickings, P., Sesardic, D., Peden, A. A. and Davletov, B. (2017) A cell line for detection of botulinum neurotoxin type B. Front. Pharmacol. 8, 796.
    Pubmed KoreaMed CrossRef
  54. Sesardic, D. and Das, R. G. .
  55. Sesardic, D., McLellan, K., Ekong, T. A. and Das, R. G. (1996) Refinement and validation of an alternative bioassay for potency testing of therapeutic botulinum type A toxin. Pharmacol. Toxicol. 78, 283-288.
    Pubmed CrossRef
  56. Sharma, S. K., Ferreira, J. L., Eblen, B. S. and Whiting, R. C. (2006) Detection of type A, B, E, and F Clostridium botulinum neurotoxins in foods by using an amplified enzyme-linked immunosorbent assay with digoxigenin-labeled antibodies. Appl. Environ.Microbiol. 72, 1231-1238.
    Pubmed KoreaMed CrossRef
  57. Silberstein, S., Mathew, N., Saper, J. and Jenkins, S. (2000) Botulinum toxin type A as a migraine preventive treatment. Headache 40, 445-450.
    Pubmed CrossRef
  58. Simon, S., Fiebig, U., Liu, Y., Tierney, R., Dano, J., Worbs, S., Endermann, T., Nevers, M. C., Volland, H. and Sesardic, D. (2015) Recommended immunological strategies to screen for botulinum neurotoxin-containing samples. Toxins 7, 5011-5034.
    Pubmed KoreaMed CrossRef
  59. Small, R. (2014) Botulinum toxin injection for facial wrinkles. Am. Fam. Physician 90, 168-175.
    Pubmed
  60. Smith, T. J., Hill, K. K. and Raphael, B. H. (2015) Historical and current perspectives on Clostridium botulinum diversity. Front. Microbiol. 166, 290-302.
    Pubmed CrossRef
  61. Snow, B. J., Tsui, J. K., Bhatt, M. H., Varelas, M., Hashimoto, S. A. and Calne, D. B. (1990) Treatment of spasticity with botulinum toxin: a double-blind study. Ann. Neurol. 28, 512-515.
    Pubmed CrossRef
  62. Stephens, M. L. (2005) Nomination of alternative methods to replace the mouse LD50 assay for botulinum toxin potency testing. Test method nomination to the ICCVAM .
  63. Szabo, E. A., Pemberton, J. M. and Desmarchelier, P. M. (1993) Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction. Appl. Environ. Microbiol. 59, 3011-3020.
    Pubmed KoreaMed CrossRef
  64. Taylor, K., Gericke, C. and Alvarez, L. R. (2019) Botulinum toxin testing on animals is still a Europe-wide issue. ALTEX 36, 81-90.
    Pubmed CrossRef
  65. Thirunavukkarasu, N., Johnson, E., Pillai, S., Hodge, D., Stanker, L., Wentz, T., Singh, B., Venkateswaran, K., McNutt, P., Adler, M., Brown, E., Hammack, T., Burr, D. and Sharma, S. (2018) Botulinum neurotoxin detection methods for public health response and surveillance. Front. Bioeng. Biotechnol. 6, 80.
    Pubmed KoreaMed CrossRef
  66. Törnqvist, E., Annas, A., Granath, B., Jalkesten, E., Cotgreave, I. and Öberg, M. (2014) Strategic focus on 3R principles reveals major reductions in the use of animals in pharmaceutical toxicity testing. PLoS ONE 9, e101638.
    Pubmed KoreaMed CrossRef
  67. Valenti, G., Fiorani, A., Li, H., Sojic, N. and Paolucci, F. (2016) Essential role of electrode materials in electrochemiluminescence applications. ChemElectroChem 3, 1990-1997.
    CrossRef
  68. von Berg, L., Stern, D., Pauly, D., Mahrhold, S., Weisemann, J., Jentsch, L., Hansbauer, E. M., Müller, C., Avondet, M. A., Rummel, A., Dorner, M. B. and Dorner, B. G. (2019) Functional detection of botulinum neurotoxin serotypes A to F by monoclonal neoepitope-specific antibodies and suspension array technology. Sci. Rep. 9, 5531.
    Pubmed KoreaMed CrossRef
  69. Wictome, M., Newton, K., Jameson, K., Hallis, B., Dunnigan, P., Mackay, E., Clarke, S., Taylor, R., Gaze, J. and Foster, K. (1999) Development of an in vitro bioassay for Clostridium botulinum type B neurotoxin in foods that is more sensitive than the mouse bioassay. Appl. Environ. Microbiol. 65, 3787-3792.
    Pubmed KoreaMed CrossRef
  70. Wilder-Kofie, T. D., Lúquez, C., Adler, M., Dykes, J. K., Coleman, J. D. and Maslanka, S. E. (2011) An alternative in vivo method to refine the mouse bioassay for botulinum toxin detection. Comp. Med. 61, 235-242.
  71. Yadirgi, G., Stickings, P., Rajagopal, S., Liu, Y. and Sesardic, D. (2017) Immuno-detection of cleaved SNAP-25 from differentiated mouse embryonic stem cells provides a sensitive assay for determination of botulinum A toxin and antitoxin potency. J. Immunol. Methods 451, 90-99.
    Pubmed CrossRef
  72. Zhang, Y., Lou, J., Jenko, K. L., Marks, J. D. and Varnum, S. M. (2012) Simultaneous and sensitive detection of six serotypes of botulinum neurotoxin using enzyme-linked immunosorbent assay-based protein antibody microarrays. Anal. Biochem. 430, 185-192.
    Pubmed KoreaMed CrossRef
  73. Zechmeister, T. C., Farnleitner, A. H., Rocke, T. E., Pittner, F., Rosengarten, R., Mach, R. L., Herzig, A. and Kirschner, A. K. (2002) PCR and ELISA: in vitro alternatives to the mouse-bioassay for assessing the botulinum-neurotoxin-C1 production potential in environmental samples? ALTEX 19 Suppl 1, 49-54.


This Article


Cited By Articles

Funding Information

Services
Social Network Service

e-submission

Archives