Biomolecules & Therapeutics : eISSN 2005-4483 / pISSN 1976-9148

Table. 1.

The PCR primer sequences use in real-time quantitative PCR

Target gene Forward (5'-3') Reverse (5'-3')
TRAP ACACAGTGATGCTGTGTGGCAACTC CCAGAGGCTTCCACATATATGATGG
NFATc1 GGGTCAGTGTGACCGAAGAT GGAAGTCAGAAGTGGGTGGA
c-Fos CCAGTCAAGAGCATCAGCAA AAGTAGTGCAGCCCGGAGTA
MMP9 AGTTTGGTGTCGCGGAGCAC TACATGAGCGCTTCCGGCAC
Cathepsin K AGGCGGCTATATGACCACTG CCGAGCCAAGAGAGCATATC
β-actin TCACCCACACTCTGCCCAT TCCTTAATGTCACGCACCATTT

TRAP, Tartrate-resistant acid phosphatase; NFATc1, Nuclear factor of activated T cells; MMP9, Matrix Metallopeptidase 9.

Biomol Ther 2020;28:337~343 https://doi.org/10.4062/biomolther.2018.216
© Biomolecules & Therapeutics